16S rDNA amplicon sequencing

DNA was extracted from the samples, and the V3–V4 region of the 16S rDNA genes was amplified by polymerase chain reaction (PCR) with a universal forward primer and a unique barcoded fusion reverse primer (341F, ACTCCTACGGGAGGCAGCAG; 806R, GGACTACHVGGGTWTCTAAT). PCR was performed using the following conditions: 3 min of denaturation at 94°C; 25 cycles of denaturation at 94°C for 45 sec, annealing at 50°C for 60 sec, and elongation at 72°C for 90 sec; and final extension at 72°C for 10 min. The amplicons were purified using AMPure beads (Axygen). Barcoded libraries were generated by emulsion PCR and sequenced in a V5 to V4 reverse direction on a 318 chip using the 400 bp sequencing kit of an Ion Torrent Personal Genome Machine (PGM) system, according to the manufacturer’s instructions [16]. The output sequences of each sample were no less than 50,000 pairs corresponding to 25,000 clean targets, and informatics methods (strategies: PE101/PE150/PE250/PE300) were applied. The clean targets were clustered by USEARCH v7.0.1090 as OTUs.