RNA Extraction and Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) Analysis

XL Xin Li
XC Xiaowei Chen
XH Xueju Hu
YS Yan Shen
RX Rui Xu
LW Leilei Wu
XS Xiaobing Shen
request Request a Protocol
ask Ask a question
Favorite

Total RNA from GC tissues and adjacent noncancerous tissues was extracted using TRIzol reagent (Invitrogen, Carlsbad, USA). Then, the concentration and purity of total RNA were measured with NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA). Reverse transcription was performed using PrimeScript™ RT kit (Takara, Tokyo, Japan). The reaction conditions of the PCR system according to 2x RealStar SYBR Mixture kit (with ROX) instruction on a StepOnePlus PCR system (Applied Biosystems, Waltham, USA) were as follows: predenaturation at 95°C for 2 min and then 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, for a total of 40 cycles. The forward primer of GUCY1A2 is TTGGATGAACTCATGGGCCG, and the reverse primer is TCAACCCATCTTGGGCCTTT. The primer sequence of β-actin used for qPCR was as follows: forward: TCCATCATGAAGTGTGACGT, reverse: GAGCAATGATCTTGATCTTCAT. We used β-actin as an internal control and compared the mRNA expression levels by the 2-ΔΔCt method.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A