FRET-qPCR assay

The newly developed FRET-qPCR targets the small subunit 18S rRNA gene and amplifies 157–165 bp fragments, the length depending on the respective Plasmodium species. We used the primers Plasmo 1 (5´-GTTAAGGGAGTGAAGACGATCAGA-3´) and Plasmo 2 (5´-AACCCAAAGACTTTGATTTCTCATAA-3) [8] and designed two target-specific hybridization probes to allow fluorescence resonance energy transfer (FRET)-based detection of amplicons. The sequences of the hybridization probes MalFL (5´- CTTTCATCCAACACCTAGTCGGC; 3´label fluorescein) and MalLC640 (5´- TAGTTTATGGTTAAGATTACGACGGT; 5´label, LC red 640, 3´phosphorylated) are identical to P. falciparum (GenBank {"type":"entrez-nucleotide","attrs":{"text":"M19172","term_id":"160642","term_text":"M19172"}}M19172, taxon ID: 5833). Fluorescence at 640 nm was generated by FRET following the annealing of both probes to their adjacent complementary sequences. Species discrimination was based on the presence of single nucleotide polymorphisms (SNPs), reducing the affinity of the MalLC640 probe for P. vivax/ knowlesi (2 mismatches), P. ovale (1 mismatch), and P. malariae (1 mismatch) and thus lowering the melting temperature (Tm) in the melting curve analysis (Fig 1). Tm is defined as the point at which half of the probes have melted off the DNA. Primers and probes were synthesized by TIB Molbiol GmbH (Berlin, Germany). PCR amplifications were performed in a reaction volume of 20 μL in sealed glass capillaries with a LightCycler 2.0 (Roche Diagnostics GmbH, Vienna, Austria), containing 1x LightCycler® FastStart DNA Master HybProbe kit, 4mM MgCl2, 4pmol of each hybridization probe, 20 pmol of each primer, and 5 μl of DNA template. In the FastStart DNA Master, HybProbe mix dTTP was replaced by dUTP, allowing the use of uracil-N-glycosylase (UNG) as an additional carryover prevention measure. Thermal cycling comprised an initial denaturation at 95°C for 10 min, followed by ten touchdown cycles (69–58°C) and 35 cycles of 95°C for 5 sec, 58°C for 10 sec, and 72°C for 15 sec. A final melting curve analysis was performed by initial denaturation at 95°C for 20 s, followed by 50°C for 20 s and continuous heating at 0.2°C/s to 70°C. Each run included negative and positive controls. Positive results were automatically determined by the software. The crossing point value (Cp) was inversely proportional to the initial Plasmodium sp. concentration in the sample and reflected only the cycles of isothermal annealing at 58°C. Melting curves and melting peaks were generated by the software and the resultant Tm values were calculated by the software. Only when the software failed to calculate the Tm properly, it was manually adjusted to peak maximum.

Melting curves of amplicons post real-time PCR from P. falciparum (red), P. malariae (green), P. ovale (lilac) and P. vivax (grey).

In addition to the 46 Plasmodium positive and 10 Plasmodium negative samples listed in Table 1, the specificity of our novel PCR was evaluated with DNA from Leishmania, Babesia, Pneumocystis, and Toxoplasma.

Cp: crossing point

*not scored: generated the correct result

Bold: false negative in the nested PCR

Tenfold dilutions were prepared from a sample with 1,000,000 to 100 P. falciparum/mL blood (uk5083). To proof the limit of detection (LOD) additional dilutions were prepared with molecular grade water corresponding to 500, 200, 100, 50, and 25 P. falciparum/mL blood. Minimum 10 replicates were tested for each dilution and the results were analyzed by Statagraphics Version 18/19.