Cell transfection and luciferase reporter (DLR) assay

miR-29c-3p mimics (including miR control, cat. no. HMI0439, concentration: ≥10⁶ TU/ml), miR-29c-3p inhibitor (including miR-29c-3p inhibitor NC, cat. no. HSTUD0440, concentration: ≥10⁶ TU/ml) were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd., shNC (cat. no. {"type":"entrez-nucleotide","attrs":{"text":"C01001","term_id":"1433231","term_text":"C01001"}}C01001, concentration: 10⁸ TU/ml), sh-circ (cat. no. {"type":"entrez-nucleotide","attrs":{"text":"C03002","term_id":"1466253","term_text":"C03002"}}C03002, concentration: 10⁸ TU/ml), pcDNA empty vector (cat. no. {"type":"entrez-nucleotide","attrs":{"text":"G01001","term_id":"684405","term_text":"G01001"}}G01001, concentration: 10⁸ TU/ml), and pcDNA-circSAMD4A (cat. no. {"type":"entrez-nucleotide","attrs":{"text":"G04002","term_id":"720960","term_text":"G04002"}}G04002, concentration: 10⁸ TU/ml) were purchased from Shanghai GenePharma Co., Ltd. The sequences of miR-29c-3p mimics were: (5′-3′) sense UAGCACCAUUUGAAAUCGGUUA, and antisense ACCGAUUUCAAAUGGUGCUAUU; mir-29c-3p inhibitor: (5′-3′) UAACCGAUUUCAAAUGGUGCUA; sh-circ: (5′-3′) AGCACAAGTACAAGAATCATT; miRNA mimic NC: (5′-3′) sense UUUGUACUACACAAAAGUACUG and (5′-3′) antisense CAGUACUUUUGUGUAGUACAAA; miRNA inhibitor NC: (5′-3′) CAGUACUUUUGUGUAGUACAAA. The cell transfection was performed using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to manufacturer's instructions for 48 h at 37°C. Then, cells were treated with 1 mM MPP⁺ solution for 24 h at 37°C.

The binding site seed regions of miR-29c-3p and 3′-UTR of circSAMD4 were determined using TargetScan (release 7.2, http://www.targetscan.org). A pmirGLO vector (Guangzhou RiboBio Co., Ltd.) containing wild-type (WT) and mutant (MUT) 3′-UTR of circSAMD4A was constructed according to the predicted binding sites. Then, cells were co-transfected with the circSAMD4A 3′-UTR-WT reporter vector or 3′-UTR-MUT reporter vector using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h. Subsequently, a dual-reporter luciferase assay system in a Tecan SpectraFluorPlus plate-reader (Tecan Group, Ltd.) was employed to determine luciferase activity.