Method details

All cells were grown at 37°C with 5% CO₂ in a water saturated atmosphere in Dulbecco’s modified Eagle’s Medium (DMEM) high glucose culture medium (GIBCO®, Life Technologies, Darmstadt, Germany) with 10% fetal calf serum (GIBCO®, Life Technologies, Darmstadt, Germany) and 60 mg/l penicillin and 100 mg/l streptomycin (Genaxxon Bioscience GmbH, Ulm, Germany). Murine Ba/F3/gp130 cells were obtained from Immunex (Seattle, WA, USA) and grown in the presence of Hyper-IL-6, a fusion protein of IL-6 and soluble IL-6 receptor (Fischer et al., 1997). 0.2% (10 ng/ml) of conditioned medium from a stable clone of CHO-K1 cells secreting Hyper-IL-6 in the supernatant (stock solution approximately 10 μg/ml as determined by ELISA) were used to maintain Ba/F3/gp130 cells and derivates thereof. The packaging cell line Phoenix-Eco was received from Ursula Klingmüller (DKFZ, Heidelberg, Germany). Phospho-STAT3 (Tyr705; D3A7; cat.#9145; 1:1000), STAT3 (124H6; cat.#9139; 1:1000), Caspase-3 (8G10; cat.#9662; 1:1000), pIκB (Ser23; 14D4; cat.#2859; 1:1000), IκB (44D4; cat.#4812; 1:1000), GFP (4B10; cat.#2955; 1:1000), Myc-Tag (71D10; cat.#2278; 1:1000) and HA-Tag (C29F4; cat. #S724S; 1:1000) monoclonal antibodies (mAbs) were purchased from Cell Signaling Technology (Frankfurt, Germany). The γ-tubulin antibody (cat. #T5326; 1:5000) mAb was obtained from Sigma Aldrich (Munich, Germany). Strep-HRP (cat.#2-1509-001; 1:10000) mAb was obrained from IBA (Goettingen, Germany).Peroxidase-conjugated secondary mAbs (cat. #31432 and #31462; 1:2500) were obtained from Pierce (Thermo Scientific, St. Leon-Rot, Germany). Alexa Flour 488 conjugated Fab goat anti-rabbit IgG (cat. #A11070; 1:500) and mCherry antibody (PA5-34974; 1:1000) was received from Thermo Fisher Scientific (Waltham, USA).

SyCyR pcDNA3.1 expression plasmids were generated by fusion of coding sequence for the IL-11R signal peptide ({"type":"entrez-protein","attrs":{"text":"Q14626","term_id":"55976300","term_text":"Q14626"}}Q14626, aa 1-22), a myc-tag (EQKLISEEDL; SyCyRs containing GFP_VHH) or a FLAG-tag (DYKDDDDK) and HA-tag (YPYDVPDYA; SyCyRs containing mCherry_VHH) followed by a nanobody (GFP_VHH or mCherry_VHH), some residues of the extracellular domain (ECD), the complete transmembrane (TMD) and complete intracellular domain (ICD) of the respective cytokine receptor. For the TNFR1-SyCyR and the TNFR2-SyCyR the coding cDNAs consist of 9 aa of the ECD and the complete TMD and ICD. The cDNA for the Fas-SyCyR consists of 10 aa of the ECD and the complete TMD and ICD of the receptor. The cDNAs for the TrailR1- and TrailR2-SyCyR consist of 10 aa of the ECD and the complete TMD and ICD. The gp130-SyCyR is made up of 13 aa from the ECD and the complete TMD and ICD. Mutation of the Fas death domain was generated by side directed mutagenesis using Phusion® high fidelity DNA polymerase (Thermo Fisher Scientific, Waltham, USA) followed by DpnI digestion of the methylated template DNA. All SyCyRs were inserted into pMOWS-hygro (Suthaus et al., 2011) (mCherry_VHH) or pMOWS-puro (Ketteler et al., 2003) (GFP_VHH) vectors for stable transfection of Ba/F3/gp130 cells. All generated cDNAs were verified by sequencing.

Synthetic ligands (sequences published in [Mossner et al., 2020b] and shown in ^{Supplemental information}) were stably expressed in CHO-K1 cells using neomycin resistance and single clone selection with 1.125 mg/ml G-418 (Genaxxon, Ulm, Germany). Transfected cells were cultivated with G-418 for two weeks and single clone selection was carried out with 0.5 cells/well. Single colonies were screened for protein expression. One clone was selected for protein expression in roller bottles (IBS Integra Biosciences, Zizers, Switzerland) with 10% low IgG fetal calf serum (GIBCO®, Life Technologies, Darmstadt, Germany) DMEM for two months. The supernatants were collected every 3-4 d and 1 L of supernatant was used for purification of Fc-tagged proteins using ProteinA MabSelect™ HiTrap™ columns (GE Healthcare, Chalfront St Giles, UK). Elution was carried out by pH shift using citrate buffer of pH 5.5 and 3.2. Buffer exchange to PBS was achieved using NAP™-25 columns (GE Healthcare, Chalfront St Giles, UK). GFP-mCherry fusion protein with Twin-Strep-tag was purified using StrepTrap™ HP column (GE Healthcare, Chalfront St Giles, UK). Elution was carried out by competitive displacement with 2.5 mM Desthiobiotin. Buffer exchange to PBS was achieved using NAPTM-25 columns (GE Healthcare, Chalfront St Giles, UK).

Ba/F3/gp130 cells were transduced retrovirally using pMOWS plasmids coding for SyCyRs. Phoenix-Eco cells were used as packaging cell line. pMOWs expression plasmids (5 μg) were transiently transfected in 6 x 10⁵ Phoenix-Eco cells using Turbofect transfection reagent (Thermo Fisher Scientific, Waltham, USA). 250 μl of the obtained retroviral supernatants were mixed with 1 x 10⁵ Ba/F3/gp130 cells and centrifuged for 2 h at 1800 rpm and RT with the addition of 8 μg/ml polybrene (Sigma Aldrich, Munich, Germany). Cells were selected with 1.5 μg/ml puromycin and/or 1 mg/ml hygromycin B for at least 2 weeks (Floss et al., 2013). After transduction cells were grown as described above and supplemented permanently with puromycin (1.5 μg/ml) and/or hygromycin B (1 mg/ml) (Carl Roth, Karlsruhe, Germany).

Ba/F3/gp130 cell lines were washed 3 times with PBS to remove cytokines from the medium. 5 x 10⁴ cells were suspended in DMEM containing 10% FCS, 60 mg/l penicillin, and 100 mg/ml streptomycin. Cells were cultured for 3 d in a volume of 100 μl with or without cytokine/synthetic ligands. The CellTiter Blue Viability Assay (Promega, Karlsruhe, Germany) was used to determine the approximate number of viable cells by measuring the fluorescence (excitation 560 nm, emission 590 nm) using the Infinite M200 Pro plate reader (Tecan, Crailsheim, Germany). After adding 20 μl per well of CellTiter Blue reagent (point 0) fluorescence was measured approximately every 20 min for up to 2 h. For each condition of an experiment 3-4 wells were measured. All values were normalized by subtracting time point 0 values from the final measurement.

Ba/F3/gp130 cell lines were washed 3 times with PBS. For the 24 h analysis, 2.5 x 10⁵ cells and for the analysis after 48 h, 1.25 x 10⁵ cells were used per well and incubated with the indicated cytokines. For the condition ethanol + Hyper-IL-6 or GFP-Fc cells were only incubated with Hyper-IL-6 or GFP-Fc. Ethanol was added to the washing steps right before the measurement. After the indicated time points, cells were washed twice with ice-cold PBS and if indicated also with 70% ethanol. Cells were resuspended in 300 μL Annexin V binding buffer (BD Bioscience, Franklin Lakes, USA) and 0.5 μL Annexin V (ImmunoTools, Oldenburg, Germany) were added. Cells were vortexed and incubated at room temperature for 15 min in the dark. Then 1 μL 7-AAD (R&D Systems, Minneapolis, USA) was added and 400 μL of AnnexinV binding buffer. Analysis was carried out by flow cytometry (BD FACSCanto II flow cytometer, BD Biosciences, San Jose, USA). Data was evaluated using FlowJo_V10 (FlowJo LLC, Ashland, USA).

Ba/F3/gp130 cells were washed 4 times with PBS to remove cytokines and starved in serum-free DMEM for 4 h. For TNFR stimulation 2.5 μM MG132 inhibitor (Sigma-Aldrich, St. Louis, USA) was added 30 min prior to stimulation. Cells incubated with IKK-2 inhibitor (Merck, Darmstadt, Germany) were pre-incubated with 18 μM IKK-2 30 min prior to stimulation. Cells were stimulated for 1 h with 100 ng/ml (or 0.1 –1000 ng/ml as indicated) purified protein, harvested, frozen in liquid nitrogen and then lysed. Stimulation of Fas-SyCyRs was carried out without serum starvation. Cells were directly stimulated in normal growth medium for 6 h with indicated cytokines. For stimulation of Fas-SyCyR cells with Caspase 3 inhibitor QVD, cells were again directly stimulated in normal growth medium for 2, 4 or 6 h. 10 μM QVD were added at the same time as the synthetic ligand. Cells were lysed for 1 h with lysis buffer containing 10 mM Tris-HCl, pH 7.8, 150 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 1 mM sodium vanadate, 10 mM MgCl₂ and a complete, EDTA-free protease inhibitor cocktail tablet (Roche Diagnostics, Mannheim, Germany). Protein concentration was determined by BCA Protein Assay (Thermo Fisher Scientific, Waltham, USA) as described by the manufacturer. Protein expression and activation was analyzed as indicated by immunoblotting of 50 μg of each analysis.

50 μg of protein were loaded per lane, separated by SDS-PAGE under reducing conditions and transferred to a polyvinylidene fluoride (PVDF) membrane (Carl Roth, Karlsruhe, Germany). Blotting of membranes was performed with 5% fat-free dried skimmed milk (Carl Roth, Karlsruhe, Germany) in TBS-T (10 mM Tris-HCl pH 7.6, 150 mM NaCl, 0.5% Tween-20) for 4 h. Primary antibodies were diluted in 5% fat-free milk in TBS-T (STAT3, Caspase-3, γ-Tubulin, Strep-HRP) or 5% bovine serum albumin in TBS-T (pSTAT3, pIκB, IκB, GFP, mCherry) and incubated at 4°C overnight. Membranes were washed with TBS-T and then incubated with the secondary peroxidase-conjugated antibodies in 5% fat-free dried skim milk in TBS-T for at least 1 h. Membranes incubated with Strep-HRP were analyzed without secondary antibody. Signal detection was achieved using the ECL Prime Western Blotting Detection Reagent (GE Healthcare, Freiburg, Germany) and the Chemo Cam Imager (INTAS Science Imaging Instruments, Göttingen, Germany).

5 μg of protein were loaded per lane and separated by SDS-PAGE. The gel was stained with Coomassie staining solution (80% ethanol, 20% acetic acid, 4% Coomassie brilliant blue R250) for 20 min and washed twice with H₂O. The gel was then destained overnight in destaining solution (20% ethanol, 10% acetic acid) and scanned for analysis.

SyCyR expression of stably transfected Ba/F3/gp130 cells was detected by specific antibodies. Cells were washed in FACS buffer (PBS, 1% bovine serum albumin) and then resuspended in 50 μl FACS buffer containing indicated specific primary antibody (myc 1:100, HA 1:1000). After incubation of at least 1 h at room temperature, cells were washed and then resuspended in 50 μl FACS buffer containing secondary antibody Alexa Fluor 488 conjugated Fab goat anti-rabbit IgG (cat. # A11070; 1:500) and incubated for 1 h at room temperature. Cells were washed and resuspended in 500 μl FACS buffer and analyzed by flow cytometry (BD FACSCanto II flow cytometer, BD Biosciences, San Jose, USA). Data was evaluated using FlowJo_V10 (FlowJo LLC, Ashland, USA).

Cells were washed 4 times with PBS and then starved in serum-free DMEM for 4 h. They were stimulated with 100 ng/ml for 60 min as indicated, harvested and frozen in liquid nitrogen. RNA isolation was carried out using RNeasy Kit (Qiagen, Hilden, Germany). RNA concentration was determined by NanoDrop 2000c spectrophotometer (Thermo Scientific, Waltham, USA) and adjusted to 50 ng/μl for all samples. The expression of specific genes was determined by usage of iTaq™ Universal SYBR Green One-Step Kit (BioRad, Hercules, USA) as described previously (Fazel Modares et al., 2019). The expression level of FasL, Traf1, IL-6, Tnfα was normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (Gapdh) for relative quantification and calculated using the Δ(Ct1) method.

The expression level of target genes was determined by AB17500 Real-Time PCR System (Thermo Scientific, Waltham, USA). The following primer pairs were used in this study: GAPDH: fw 5’: GAAGGGCTCATGACCACAGT, rev 5’: CATTGTCATACCAGGAAATGAGCT; FasL: fw 5’: GCGGGTTCGTGAAACTGATAA, rev 5’: GCAAAATGGGCCTCCTTGATA; Traf1: fw 5’: AGGGTGGTGGAATTACAGCAA, rev 5’: GCAGTGTAGAAAGCTGGAGAG; IL-6: fw 5’: CAAAGCCAGAGTCCTTCAGA, rev 5’: GATGGTCTTGGTCCTTAGCC; TNFα: fw 5’: CTGAACTTCGGGGTGATCGG, rev 5’: GGCTTGTCACTCGAATTTTGAGA.