RNA Extraction and Real-time Quantitative RT-PCR

Total RNA was extracted from clinical samples using the QIAamp viral RNA mini Kit (Qiagen, Germany), following the manufacturer’s instructions. The RNA was eluted in a final volume of 60 μL of elution buffer and used immediately or stored at -80°C.

In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China). The digestion products were both transcribed in vitro into RNAs and purified by a RioMAX large-scale RNA production system-T7 (Promega). Finally, the RNA panels were serially diluted from 2.5 × 10⁶ to 2.5 copies per μL. Since the primers and probe were designed based to amplify the 226 bp cloned fragment, the RNA panels were used as a standard for real-time quantitative RT-PCR and EV71 viral load testing as in our previous studies [15, 16]. The real-time quantitative RT-PCR assay was performed using primers (P1, CCATAAGAACTACACTATGAATATGT, P2, AGTCCACTRCTCACGCTATC), probe (CAGACGTGCACCATCCAGTGAG) and the QIAGEN QuantiTectTM Probe RT-PCR Kit (Qiagen, Germany). The conditions for real-time RT-PCR reaction included 50°C for 30 min, 95°C for 15 min, 45 cycles of 95°C for 20 s, 55°C for 40 s, 68°C for 30 s. Data were analyzed using the software supplied by the manufacturer. The quantitative real-time PCR assay was performed to detect copy number of viral load in stool specimens of the HFMD patients.