HPRT gene mutation assay

HPRT gene mutation assay was modified and conducted as described previously^30,31. DLD1 and DLD1 + MSH6 cells were cultured for several passages in RPMI-1640 + 10% FBS containing 100 μM hypoxanthine, 0.4 μM aminopterin, and 16 μM thymidine to pre-clean of the pre-existing mutants. Approximately 2 × 10⁵ cells were seeded in triplicate onto 10-cm dishes treated with 20 μM freshly prepared 6-TG and incubated for about 12 days. Survived colonies were isolated and expanded to extract mRNA. The HPRT1 cDNA was amplified with primers (HPRT1-F- GCGCGCCGGCCGGCTCCGTT; HPRT1-R-GGCGATGTCAATAGGACTCCAGATG) targeting the entire coding region and sequenced. Plating efficiency was determined by seeding 100 cells in the absence of 6-TG. After 10 days-culture, colonies were visualized by staining with 0.1% crystal violet. The mutation frequency was determined by dividing the number of 6-TG resistant colonies by the total number of cells plated after being corrected for the colony-forming ability. Specifically, mutation frequency = number of mutant colonies/(cloning efficiency × cells seeded for mutation assay) and cloning efficiency = no. of colonies/no. of cells seeded.