4.5. Rat STZ-Induced Diabetic Retinopathy Model

Male Sprague-Dawley rats (200–250 g) were obtained from Envigo (San Pietro a Nadisone, Udine, Italy). All the animals were treated according to the ARVO Statement for the Use of Animals in Ophthalmology and Vision Research and protocols were approved by the Italian Ministry of Health (authorization n. 1172/2016-PR). Animals were housed under standard conditions, with free access to water and standard chow, in a light-controlled (12 h light/dark cycle) room with standard temperature and humidity conditions. The induction of diabetes was performed by a single dose of STZ (60 mg/kg) that was intraperitoneally injected. After 24 h, the diabetic state of all animals was evaluated using a blood glucose meter and only animals with blood glucose levels greater than 250 mg/dL were considered diabetic. Diabetic rats body weight has been monitored during the study (no more than 10% body weight loss was observed in diabetic rats). Starting from the day when the glycemia was measured, 36 animals were randomly assigned to three experimental groups (n = 12 each group): (1) control group, treated with intraperitoneal injection of citrate buffer and topical administration of vehicle NaMESys (CTRL); (2) positive control group, injected with STZ (60 mg/kg, i.p.) and topically treated with vehicle (NaMESys); (3) treated group, injected with STZ (60 mg/kg, i.p.) and topically treated with microemulsion carrying 0.3% sorafenib tosylate (NaMESys-SOR). All animals received two daily administrations (12 µL/eye) NaMESys or NaMESys-SOR for 21 days, in both eyes. At the end of the treatment course, animals were sacrificed by CO₂ inhalation, the eyes enucleated, and the retinas collected and stored at −80 °C until used for gene and protein analyses by quantitative real-time PCR and WB, respectively. In particular, 12 retinas per experimental group, from 36 animals, were processed for WB analyses, while the remaining 12 retinas per experimental group, from 36 animals, were processed for quantitative real-time PCR analyses. As regards quantitative real-time PCR analyses, retinal samples have been homogenized with TRIzol reagent in order to proceed with total RNA extraction. Purity and concentration of RNA extracts were assessed through photometric analysis with the BioPhotometer instrument (Eppendorf^®). For each sample, 10 μg/μL mRNA wwas retrotranscribed using the following reagents: Oligo(dT)20 primers, dNTP Set 100 mM and the SuperScript^® III Reverse Transcriptase kit. Thereafter, 50 ng/μL cDNA for each sample were added of Applied Biosystems^® SYBR^® Green PCR Master Mix for the real-time PCR analysis by means of the Applied Biosystems^® 7500 Real-Time PCR Systems. The primers for target genes are hereby listed: TNFα forward: GAGCACGGAAAGCATGATCC and reverse: TAGACAGAAGAGCGTGGTGG; NFκB forward: CATCCACCTTCATGCTCAGC and reverse: TCCACCACATCTTCCTGCTT; VEGFR1 forward: AGGAAACAGAATCGAGGGCA and reverse: GCCTTGCAGCTGTAGATTCC; VEGFR2 forward: TTGGAAACTGAATGGCACCG and reverse: GCAGAGCAGACATAGTTGCC; IGF1 forward: TTCCGGAGCTGTGATCTGAG and reverse: TGAGTCTTGGGCATGTCAGT; IGF1R forward: TGTCCTCTCGGCATCAAACT and reverse: AGTAGTTGTGCCGGAACAGA. Gene expression was normalized using the S18 “housekeeping” gene. Results were analyzed with the 2^−ΔΔCt method. Quantitative real-time PCR adhered to the MiQE guidelines, and each sample has been run in triplicate. As regards the WB analysis, retinas were homogenized in a buffer containing 20 mM Tris (pH 7.4), 2 mM EDTA, 0.5 mM EGTA, 50 mM mercaptoethanol, 0.32 mM sucrose and a protease inhibitor cocktail, sonicated and centrifuged at 10,000 rpm for 10 min at 4 °C. Protein concentration was analyzed with the Quant-it Kit Protein Assay. For each sample, 40 µg of proteins was diluted with 2× Laemmli buffer and β-mercaptoethanol (20:1) and denaturated at 70 °C for 10 min. After that proteins were loaded in a mini-PROTEAN TGX precast gels and gel electrophoresis was carried out. Separated proteins have been transferred to a nitrocellulose membrane that was blocked with the Odissey blocking buffer (LI-COR) and incubated with specific primary antibody for anti-TNFα (sc-52746, 1:200), anti-VEGFR1 (Flt-1 (C-17) (sc-316, 1:500) and anti-VEGFR2 (Flk-1 (A-3) (sc-6251, 1:500). Immunoblots were normalized to β-tubulin expression (rabbit anti β-tubulin, sc-9104; 1:500). After overnight incubation with primary antibodies, membranes were washed with Tris-buffered saline-Tween20 (TBST) and then incubated with secondary antibodies anti-rabbit IRDye 800CW and anti-mouse IRDye 680 CW. Immunoblot detection was carried out with the Odyssey Infrared Imaging System (LI-COR; Lincoln, Nebraska, USA). Densitometric analysis was carried out with the ImageJ software (ImageJ software https://imagej.net/Welcome. Last accessed 1 April 2021).