Real-Time PCR Analysis

PSORI-CM02-treated HUVECs were harvested 6 h after the addition of IL-17A to analyse the expression of IL-1β, TNF-α, IL-6,and GAPDH mRNAs. Skin tissues were also collected from mice to analyse the mRNA expression levels of IL-6, TNF-α, IL-17A, IL-17F, VEGF, HIF-1α, and GAPDH. Total RNA was isolated using TRIzol reagent. RNA purity and concentrations were assessed using a NanoDrop 2000 instrument (Thermo Fisher Scientific, Waltham, MA, USA). RNA samples were then reverse-transcribed into cDNA using an RT-PCR kit, according to the manufacturer’s instructions. The PCR amplification conditions involved an initial denaturation step at 95°C for 15 s, followed by 35 cycles of denaturation at 95°C for 5 s and annealing at 61°C for 15 s. Real-time PCR was performed using SYBR Premix Ex TaqTM II (Takara, Kusatsu, Japan) and a ViiA7 real-time PCR instrument (Thermo Fisher Scientific). The sequences of the respective human sense and antisense primers were as follows (from 5′ to 3′): IL-6, CCACCGGGAACGAAAGAGAA and TCTTCTCCTGGGGGTACTGG; IL-1β, GTTCCCTGCCCACAGACCT and TGGACCAGACATCACCAAGC; TNF-α, CACGCTCTTCTGCCTGCT and GCTTGTCACTCGGGGTTC; and GAPDH, TGTGGGCATCAATGGATTTGG and ACACCATGTATTCCGGGTCAAT. The sequences of the respective mouse sense and antisense primers were as follows (from 5′ to 3′): IL-6, GAGGATACCACTCCCAACAGACC and AAGTGCATCATCGTTGTTCATACA; TNF-α, GGGTGTTCATCCATTCTCTACC and GTCCCAG-CATCTTGTGTTTC; IL-17A, CTGACCCCTAAGAAACCCC and GAAGCAGTTTGGGACCCCTT; IL-17F, ACGTGAATTCCAGAACCGCTA and TGATGCAGCCTGAGTGTCTG; VEGF, TATTCAGCGGACTCACCAGC and AACCAACCTCCTCAAACCGT; HIF-1α, CTTGACAAGCTAGCCGGAGG and TCGACGTTCAGAACTCATCCT; and GAPDH, AAGAGGGATGCTGCCCTTAC and TACGGCCAAATCCGTTCACA. Relative mRNA quantities were determined using the 2^-ΔΔCt method, with data normalised to the GAPDH housekeeping gene.