Primer design and PCR optimization for the 23S-5S IGS.

A set of new primers were designed for a nested PCR assay targeting an ∼350-bp DNA fragment from the 23S-5S IGS region of Rickettsia. The 23S-5S IGS sequences of some Rickettsia spp. (including SFG and ancestral groups) were retrieved from GenBank and aligned using the Clustal W program (27). We used the MEGA version 6 software package (28) to identify 20- to 22-bp regions that were conserved among all groups of Rickettsia. The newly designed nested-PCR primers were RCK/23-5N1F (5′ TGTGGAAGCACAGTAATGTGTG 3′) and RCK/23-5N1R (5′ TCGTGTGTTTCACTCATGCT 3′). The amplification conditions of the thermocycler were optimized by conducting temperature gradient PCR on genomic DNA (gDNA) of some known Rickettsia species (positive-control DNA) and on tick samples that were previously identified as positive for rickettsiae. After optimization, assays were conducted on genomic DNA from 11 known species of Rickettsia belonging to the SFG and the typhus and ancestral groups (Table 1). The DNAs for the Rickettsia spp. were obtained from the Rickettsial Zoonoses Branch, Centers for Disease Control and Prevention (Atlanta, GA, USA), except for R. monacensis, for which cell culture material was obtained from Fuller Laboratories (Fullerton, CA, USA).

Amplification of four gene/IGS targets of 11 Rickettsia species with an initial template (gDNA) concentration of 2 ng/μl

Primary PCR amplifications were conducted in a 20-μl reaction mixture consisting of 1 μl of genomic DNA (2 ng), 10 μl of AmpliTaq Gold PCR master mix (catalog no. 4398881; Life Technologies, USA), 1 μl of primer RCK/23-5-F (10 μM), 1 μl of primer RCK/23-5-R (10 μM) (22), and 7 μl of nuclease-free water. The nested-PCR mixture consisted of 1 μl of primary amplicons as template DNA, 10 μl of AmpliTaq Gold PCR master mix, 1 μl of primer RCK/23-5N1F (10 μM), 1 μl of primer RCK/23-5N1R (10 μM), and 7 μl of nuclease-free water. Biotin-modified (5′ end) nested primers were used if the amplicons were to be used in RLB hybridization reactions. The PCR conditions used for amplification of 23S-5S IGS fragments were as follows: 95°C for 10 min, 35 cycles of 94°C for 30 s, 60°C for 30 s, and 65°C for 1.5 min, and a final cycle of 65°C for 7 min (for the primary reaction; modified protocol of Lee et al. [23]) and 95°C for 10 min, 30 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 1.5 min, and a final cycle of 72°C for 10 min (for the nested reaction). All the primers and probes used in this study were ordered from Life Technologies (Grand Island, NY, USA).