microRNA in situ hybridization (ISH) and miRNAscope assay

For all experimental procedures, we used diethylpyrocarbonate (DEPC)-treated water or PBS for washing steps or reagent preparation. Spinal cord cryosections were initially treated with 10 μg/mL proteinase K (Invitrogen), followed by acetylation in acetic anhydride/triethanolamine, and then fixed again with 4% PFA. Next, sections were pre-hybridized in hybridization solution [50% formamide, 5 X SSC, 0.5 mg/mL yeast tRNA (Ambion), 5 X Denhardt’s solution (Fisher), 0.5 mg/ml salmon sperm DNA (Thermo Fisher Scientific), 0.02% Roche blocking reagent] at room temperature for 2 ~ 4 hr, followed by hybridization with each miRNA probe overnight at 55°C. After post-hybridization washes in 2 X SSC and then 0.2 X SSC at 55°C, the in situ hybridization signals were detected using the NBT/BCIP (Roche) system according to the manufacturer’s instructions. After termination of color development, slides were subjected to immunostaining as described below. Slides were mounted in Aqua-Poly/Mount and analyzed with a Zeiss LSM 780 confocal microscope. The 5’ FITC-labeled LNA MiR34a-5p probe (ACAACCAGCTAAGACACTGCCA) was purchased from Exiqon.

To detect MiR34c-5p, spinal cord samples were dissected and fixed with 4% PFA, as described previously (Tung et al., 2019; Yen et al., 2018). The cryostat sections were processed using miRNAscope technology (Advanced Cell Diagnostics, ACD) according to the manufacturer’s instructions. The probe to detect mmu-MiR34c-5p was customized from 896831-S1 (ACD).