Plasmids and transgenic strains

ZB Zita Balklava
NR Navin D. Rathnakumar
SV Shilpa Vashist
PS Peter J. Schweinsberg
BG Barth D. Grant
request Request a Protocol
ask Ask a question
Favorite

All cloning was performed using the Gateway cloning system (Invitrogen, Carlsbad, CA). All the destination vectors were adapted for the Gateway cloning system by insertion of appropriate Gateway cassettes.

To express the pitr-1p::gfp fusion, a 5.2-kb upstream sequence of pitr-1 was amplified and cloned into pDONR221 and then transferred into pPD95.75-Gtwy by Gateway recombination. To express functional GFP-tagged PITR-1, pitr-1 coding sequences from the start to the stop were amplified from genomic DNA and cloned into pDONR221 by Gateway cloning. GFP(S65C) with C. elegans introns was then PCR amplified from plasmid pPD117.01 (gift of A. Fire) and cloned into a SpeI site introduced by site-directed mutagenesis and transferred into vector pID2.01B (pie-1 promoter) for germline expression (gift from Geraldine Seydoux) (Gallo et al. 2008) or vector pPS2 (vha-6 promoter) for intestine-specific expression, using the Gateway LR reaction. This inserted GFP after Q522, within the predicted large extra cytosolic loop of pitr-1 (between transmembrane domains TM7 and TM8). All integrated transgenic lines were obtained by the microparticle bombardment method (Praitis et al. 2001). Destination vectors containing Cbr-unc-119 gene from C. briggsae were bombarded individually, but destination vectors without integrated unc-119 gene were cobombarded with plasmid MM016B encoding the WT unc-119 gene into unc-119(ed3) mutant worms.

CRISPR-Cas9-mediated gene editing was performed as described in Paix et al. (2015) using the co-CRISPR method. The guide CRISPR targeting RNA (crRNA) (auaguugguugaucgagaag) and primers for amplifying the GFP repair template (gaaaatatcttgaatccgacaataacggtcaacctATGAGTAAAGGAGAAGAACTTT and catgtactgactacaatagttggttgatcgagaagTTTGTATAGTTCGTCCATGC) were synthesized by IDT (Coralville, IA). Homology arms added to GFP are underlined. GFP (S65T) with C. elegans introns was amplified from plasmid pPD114.108 (gift of A. Fire).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A