Quantitative RT-PCR (qRT-PCR)

To measure cytokine expression at the RNA level, RNA was isolated with TRI Reagent (Sigma-Aldrich) according to the manufacturer’s protocol. The concentration of the extracted RNA was determined with a NanoDrop spectrophotometer (Thermo Scientific) and the A260/A280 ratio was always ≥ 1.8. Reverse transcription was performed with 1 µg RNA and the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The KAPA SYBR FAST qPCR Master Mix (2X) Kit (Sigma-Aldrich) was used to quantify gene expression on a 7900-HT Fast Real Time PCR instrument (Applied Biosystems). The 2^−ΔΔCt method was used for qRT-PCR gene expression analysis [38]. Genes of interest were compared with the housekeeping gene GAPDH. Primers used to measure the RNA expression of IL-1β, IL-6, IL-8, IFN-β, TNF-β, TLR2, TLR3, and TLR4 were: IL-1β forward: CTGTCCTGCGTGTTGAAAGA; IL-1β reverse: GGGAACTGGGCAGACTCAAA. IL-6 forward: GGAGACTTGCCTGGTGAAAA; IL-6 reverse: GTCAGGGGTGGTTATTGCAT. IL-8 forward: ACTGAGAGTGATTGAGAGTGGAC; IL-8 reverse: AACCCTCTGCACCCAGTTTTC. TNF-α forward: CCCCAGGGACCTCTCTCTAATC; TNF-α reverse: GGTTTGCTACAACATGGGCTACA. IFN-β forward: CAGCAATTTTCAGTGTCAGAAGC; IFN-β reverse: TCATCCTGTCCTTGAGGCAGT. TLR2 forward: CTTCACTCAGGAGCAGCAAGCA; TLR2 reverse: ACACCAGTGCTGTCCTGTGACA. TLR3 forward: GCGCTAAAAAGTGAAGAACTGGAT; TLR3 reverse: GCTGGACATTGTTCAGAAAGAGG. TLR4 forward: CCCTGAGGCATTTAGGCAGCTA; TLR4 reverse: AGGTAGAGAGGTGGCTTAGGCT.