2.4. Validation of differentially expressed circular RNAs by Sanger sequencing and qRT‐PCR

The following primer sequences were used to amplify PCR fragments of three circular RNAs hsa_circ_0006743Fwd 5′‐GCCTGCATTGGTGTATGT‐3′; Rev 5′‐GCCCAGATTAAGTGGTATTCC‐3′, hsa_circ_0002496 Fwd 5′‐CTCATGAAGATTTGGCCTACT‐3′; Rev 5′‐TTACTACACAAGCAGTGCATT‐3′, hsa_circ_0023990 Fwd 5′‐TCTACATATGCAATAAGCTAGGATT‐3′; Rev 5′‐ TCGGAGGTAAGCCAAGAG‐3′ and amplifying Glyceraldehyde 3‐phosphate dehydrogenase gene fragment as internal reference using the primer sequences GAPDH Fwd 5′‐TGCACCACCAACTGCTTAGC‐3′; GAPDH Rev 5′‐ GGCATGGACTGTGGTCATGAG‐3′. Using GoTaq SYBR green master mix (Promega Corporation), circular RNA expression was validated using the above set of primers in Quantstudio^™ 12K Flex (Applied Biosystems, Thermo Fisher Scientific) encompassing the junction site to ensure specificity. Genetic Analyzer 3500 DX (Applied Biosystems, Thermo Fisher Scientific) was used to confirm circular RNA sequences.