2.13. In situ hybridization staining

The localization of miR‐130a was observed by in situ hybridization (ISH). miR‐130a FISH Probe was purchased from Exonbio Inc (Guangzhou China) and labelled with DIG. In situ observation of miR‐130a was performed using 4‐μm sections of samples with a digoxigenin‐labelled oligonucleotide lncRNA‐TR detection probe (Exiqon, Aarhus C, Denmark), as previously described. miR‐130a probe sequence was (5′‐3′): Dig‐5‐ATGCCCTTTTAACATTGCACTG‐3.