Single guide RNA targeting a region in exon 10 of mouse Nedd4-2 was cloned into the Px459 vector (Addgene), following the Zhang Genome engineering CRISPR–Cas9 protocol45. The following primers were used: F: 5′ CACCGACCGACGCTTCCGCTCTCGG 3′, R: 5′ AAACCCGAGTGCGGAAGCGTCGGTC 3′. The plasmid was transfected using Lipofectamine 3000 reagent (Invitrogen), with an empty Px459 vector serving as a control to generate wild-type clones. After 24 h, media was replaced and supplemented with 2.5 μg/mL puromycin (Sigma-Aldrich) for a further 24 h to select for transfected cells. Surviving cells were passaged at low seeding density and single colonies selected and propagated. Deletion of Nedd4-2 was confirmed by sequencing of the region in exon 10 and immunoblotting for NEDD4-2 protein. Four clonal cell lines were selected for analysis for both NEDD4-2 KO and wild-type (empty Px459 vector) controls.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.