Generation of Nedd4-2 KO CCD cell lines

Single guide RNA targeting a region in exon 10 of mouse Nedd4-2 was cloned into the Px459 vector (Addgene), following the Zhang Genome engineering CRISPR–Cas9 protocol⁴⁵. The following primers were used: F: 5′ CACCGACCGACGCTTCCGCTCTCGG 3′, R: 5′ AAACCCGAGTGCGGAAGCGTCGGTC 3′. The plasmid was transfected using Lipofectamine 3000 reagent (Invitrogen), with an empty Px459 vector serving as a control to generate wild-type clones. After 24 h, media was replaced and supplemented with 2.5 μg/mL puromycin (Sigma-Aldrich) for a further 24 h to select for transfected cells. Surviving cells were passaged at low seeding density and single colonies selected and propagated. Deletion of Nedd4-2 was confirmed by sequencing of the region in exon 10 and immunoblotting for NEDD4-2 protein. Four clonal cell lines were selected for analysis for both NEDD4-2 KO and wild-type (empty Px459 vector) controls.