Cleavage Under Targets and Tagmentation (CUT&Tag) and Quantitative RT-PCR Analysis

XH Xiangru Huang
AJ Anting Jin
XW Xijun Wang
XG Xin Gao
HX Hongyuan Xu
MC Miri Chung
QD Qinggang Dai
YY Yiling Yang
LJ Lingyong Jiang
request Request a Protocol
ask Ask a question
Favorite

The CUT&Tag assay was performed with the Hyperactive In Situ ChIP Library Prep Kit for Illumina (Vazyme, Cat#: TD901-01) as previously described according to the manufacturer’s instructions (Kaya-Okur et al., 2019; Dan et al., 2020). Briefly, C3H10 T1/2 cells treated with 0.1 μM Napabucasin or vehicle control were washed with wash buffer containing 1× protease inhibitor cocktail (Sigma-Aldrich, Cat#: 5056489001). Cell pellets were resuspended in wash buffer and Concanavalin A-coated magnetic beads were added and incubated at room temperature. Bead-bound cells were resuspended in antibody buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.05% digitonin, 2 mM EDTA, 0.1% BSA and 1× protease inhibitor cocktail). Then, 1 μg of STAT3 antibody (Cell Signaling Technology, Cat#: D3Z2G) or normal IgG (Cell Signaling Technology, Cat#: 2729) was added and incubated overnight at 4°C. After removing the primary antibody, 1 μg of secondary antibody (Vazyme, Cat#: ab206) diluted in Dig-wash buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.05% digitonin and 1× protease inhibitor cocktail) was added and incubated at room temperature. The cells were then incubated with Hyperactive pG-Tn5 Transposase diluted in Dig-300 buffer (20 mM HEPES pH 7.5, 300 mM NaCl, 0.5 mM spermidine, 0.01% digitonin and 1× protease inhibitor cocktail) at room temperature for 1.5 h. Finally, the cells were resuspended in tagmentation buffer (10 mM MgCl2 in Dig-300 buffer) and incubated at 37°C for 1.5 h. DNA was purified using phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation after RNase A treatment. Precipitated DNA was detected by quantitative RT-PCR with specific primers. The primers for the STAT3 binding site in the Ocn promoter were 5′GGATACCCCATGTTCCCAGC3′ and 5′TGCAGCCCGTCTACTGGAGC3′.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A