Cleavage Under Targets and Tagmentation (CUT&Tag) and Quantitative RT-PCR Analysis

The CUT&Tag assay was performed with the Hyperactive In Situ ChIP Library Prep Kit for Illumina (Vazyme, Cat#: TD901-01) as previously described according to the manufacturer’s instructions (Kaya-Okur et al., 2019; Dan et al., 2020). Briefly, C3H10 T1/2 cells treated with 0.1 μM Napabucasin or vehicle control were washed with wash buffer containing 1× protease inhibitor cocktail (Sigma-Aldrich, Cat#: 5056489001). Cell pellets were resuspended in wash buffer and Concanavalin A-coated magnetic beads were added and incubated at room temperature. Bead-bound cells were resuspended in antibody buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.05% digitonin, 2 mM EDTA, 0.1% BSA and 1× protease inhibitor cocktail). Then, 1 μg of STAT3 antibody (Cell Signaling Technology, Cat#: D3Z2G) or normal IgG (Cell Signaling Technology, Cat#: 2729) was added and incubated overnight at 4°C. After removing the primary antibody, 1 μg of secondary antibody (Vazyme, Cat#: ab206) diluted in Dig-wash buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 0.05% digitonin and 1× protease inhibitor cocktail) was added and incubated at room temperature. The cells were then incubated with Hyperactive pG-Tn5 Transposase diluted in Dig-300 buffer (20 mM HEPES pH 7.5, 300 mM NaCl, 0.5 mM spermidine, 0.01% digitonin and 1× protease inhibitor cocktail) at room temperature for 1.5 h. Finally, the cells were resuspended in tagmentation buffer (10 mM MgCl₂ in Dig-300 buffer) and incubated at 37°C for 1.5 h. DNA was purified using phenol-chloroform-isoamyl alcohol extraction and ethanol precipitation after RNase A treatment. Precipitated DNA was detected by quantitative RT-PCR with specific primers. The primers for the STAT3 binding site in the Ocn promoter were 5′GGATACCCCATGTTCCCAGC3′ and 5′TGCAGCCCGTCTACTGGAGC3′.