RNA was purified using TRIzol Reagent (Ambient #15596018) from thymus, spleen, pituitary gland, cultured BMMs, and cultured splenocytes obtained from male C57BL/6NTac mice (9–12 weeks of age). BMMs and splenocytes were either naïve or activated for 24 hours with 100 ng/mL LPS or for 48 hours with 3.0 μg soluble anti‐mouse CD3ε, respectively.
Conversion to cDNA was performed with iScript cDNA synthesis kit (BioRad #170‐8891) on 1 μg and 700 ng total RNA from tissue samples and cultured cells, respectively. For Gnrhr reverse transcription polymerase chain reaction (RT‐PCR), 1 μL of pituitary cDNA, and 7.5 μL of spleen or thymus cDNA were used as templates using the following PCR program: 94°C, 3 minutes for ×1 cycle, 94°C for 20 s, 56°C for 30 s, and 72°C for 1 minute ×35 cycles, and 72°C for 7 minutes ×1 cycle. β2‐microglobulin was used as the reference gene. For the β2‐microglobulin RT‐PCR, 0.5 μL cDNA was used as template for all tissue and cell samples using the following PCR program: 94°C, 3 minutes for ×1 cycle, 94°C for 20 s, 60°C for 30 s, and 72°C for 25 s ×35 cycles, and 72°C for 7 minutes ×1 cycle. The primers 5′‐TTCCACAGTGGTGGCATCAG‐3′ and 5′‐GTCCAGCAGACGACAAAGGA‐3′ were used for amplification of the GnRH receptor, whereas β2‐microglobulin was detected using the primers 5′‐CTGCTACGTAACACAGTTCCACCC‐3′ and 5′‐CATGATGCTTGATCACATGTCTCG‐3′.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.