GnRH Receptor Expression in Tissue and Cultured Cells

RNA was purified using TRIzol Reagent (Ambient #15596018) from thymus, spleen, pituitary gland, cultured BMMs, and cultured splenocytes obtained from male C57BL/6NTac mice (9–12 weeks of age). BMMs and splenocytes were either naïve or activated for 24 hours with 100 ng/mL LPS or for 48 hours with 3.0 μg soluble anti‐mouse CD3ε, respectively.

Conversion to cDNA was performed with iScript cDNA synthesis kit (BioRad #170‐8891) on 1 μg and 700 ng total RNA from tissue samples and cultured cells, respectively. For Gnrhr reverse transcription polymerase chain reaction (RT‐PCR), 1 μL of pituitary cDNA, and 7.5 μL of spleen or thymus cDNA were used as templates using the following PCR program: 94°C, 3 minutes for ×1 cycle, 94°C for 20 s, 56°C for 30 s, and 72°C for 1 minute ×35 cycles, and 72°C for 7 minutes ×1 cycle. β2‐microglobulin was used as the reference gene. For the β2‐microglobulin RT‐PCR, 0.5 μL cDNA was used as template for all tissue and cell samples using the following PCR program: 94°C, 3 minutes for ×1 cycle, 94°C for 20 s, 60°C for 30 s, and 72°C for 25 s ×35 cycles, and 72°C for 7 minutes ×1 cycle. The primers 5′‐TTCCACAGTGGTGGCATCAG‐3′ and 5′‐GTCCAGCAGACGACAAAGGA‐3′ were used for amplification of the GnRH receptor, whereas β2‐microglobulin was detected using the primers 5′‐CTGCTACGTAACACAGTTCCACCC‐3′ and 5′‐CATGATGCTTGATCACATGTCTCG‐3′.