Quantification of Mitochondrial DNA Copy Number

Oocytes were transferred individually to a 200 μl tube containing 10 μl lysis buffers (50 mM Tris-HCl, 0.1 mM EDTA, 0.5% Tween-20 and 200 mg/ml proteinase K) and incubated at 55°C for 20 min and then at 95°C for 10 min sequentially to release the DNA. qPCR primers for rat mtDNA sequences (mtND2) (forward primer: CCTCATAGGGCCTGTAATCACT; reverse primer: GCTGCTTCAGTTGATCGTGG) were designed. Absolute quantification of the mtDNA copy number was performed, and template DNA was extracted from oocytes for the construction of the pESI-T vector, linked with mtND2 gene and validated with Sanger sequencing (Takeo et al., 2014, 2015; Hou et al., 2018). qRT-PCR was then performed to quantify the copy number of mtND2. PCR conditions were as follows: 95°C for 5 min and 40 cycles at 95°C for 10 s and 60°C for 30 s. A standard curve was plotted with eight 10-fold serial dilutions of the external standard for the determination of the mtDNA copy number.