For gene expression analysis by qPCR, total RNA was extracted with TRIzol Reagent (Thermo Fisher Scientific) and processed according to the instructions of the manufacturer. Reverse transcription was performed using 1 μg of input RNA from each sample with iScript RT Supermix (Bio-Rad Laboratories), and 4-fold diluted cDNA was used for each PCR reaction. For a 20 μL of PCR, 50 ng of cDNA was mixed with primers to final concentration of 150 nM and 10 μL of Brilliant SYBR®Green QPCR Master Mix and ROX (Agilent Technologies Inc., Santa Clara, California, USA) as reference dye. The reaction was first incubated at 95 °C for 3 min, followed by 40 cycles at 95 °C for 30 s and 60 °C for 1 min. qPCR was performed by monitoring in real-time the increase in fluorescence on an Mx3000P™Real-Time PCR detector system (Agilent Technologies). Results were analysed using the 2-DDCt method to calculate the relative level of each mRNA and expressed as a ratio relative to 18S rRNA, Beta-actin or Gapdh housekeeping genes. The following primers were used: 18S: forward CGGACACGGACAGGATTGACAG, reverse ATCGCTCCACCAACTAAGAACGG; Beta-actin: forward CACTCTTCCAGCCTTCCTTCC, reverse ACAGCACTGTGTTGGCGTAC; GAPDH: forward GTCAGTGGTGGACCTGACCT, reverse TGCTGTAGCCAAATTCGTTG; HPRT: forward CGAGATGTGATGAAGGAGATGGG, reverse GATGTAATCCAGCAGGTCAGCAA; Per1: forward CTGGCAATGGCAAGGACTC, reverse AGGAGGCTGTAGGCAATGG; Per2: forward CGCCTAGAATCCCTCCTGAGA, reverse CCACCGGCCTGTAGGATCT; PER1: forward CAGTGCTCCTGTTCCTGCATC, reverse CCCGCCAACTGCAGAATCT; PER2: forward AATGCCGATATGTTTGCGGT, reverse GCATCGCTGAAGGCATCTCT; BMAL1: forward CCAGAGGCCCCTAACTCCTC, reverse TGGTCTGCCATTGGATGATCT; NR1D1: forward CCGTGACCTTTCTCAGCATGA, reverse GACTGTCTGGTCCTTCACGTTG; PER1 promo: forward TGTCTCTCCCCTCCTCTCAA, reverse AGATACGCTGCGCCTCTTTA; TRP53: forward TTTGCGTGTGGAGTATTTGGATG, reverse CCAGTGTGATGATGGTGAGG; MDM2: forward GAATCATCGGACTCAGGTACATC, reverse TCTGTCTCACTAATTGCTCTCCT; BAX: forward CTGCAGAGGATGATTGCCG, reverse TGCCACTCGGAAAAAGACCT; BCL2: forward TCCCTCGCTGCACAAATACTC, reverse ACGACCCGATGGCCATAGA.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.