RNA in vitro transcription and purification

RNA was prepared using in vitro transcription with T7 polymerase. The DNA template was obtained from a linearized vector. RNAs used in NMR experiments were transcribed with an HDV-ribozyme that cleaves at the end of the target RNA sequence, resulting in the presence of a 3′ cyclic phosphate. The 3′ cyclic phosphate prevents degradation of the RNA by the exosome and thus allows for long-term NMR measurements. RNAs used in binding and degradation experiments were produced using run-off transcription, where the final RNA contained a 3′ GCT that resulted from the linearization of the template vector with the HindIII restriction enzyme. All RNA constructs contained a hairpin structure (GGCCCCCCCCGAAAGGGGGGGG) followed by 32, 63, 92 or 118 adenines (Supplementary Table S1). The DNA vector containing 63, 92 or 118 adenines were obtained from gene-synthesis (GenScript USA Inc.). In vitro transcribed RNA was purified natively with weak ion exchange chromatography using a DEAE-sepharose column as described (21). The pooled fractions were concentrated and buffer exchanged into H₂O with a PD10 column, followed by SpeedVac concentration.