Cloning and characterisation of Mbv 2122/97 mpb70 knock-out and complemented strains

A knockout mutant in the mpb70 gene (Mb2900) of Mbv 2122/97 was constructed using the phAE159 shuttle phasmid. One kb regions flanking the chromosomal Mbv mpb70 were cloned into phAE159 so as to flank a hygromycin resistance marker to generate the allelic exchange substrate (S5A Fig and S3 Table). After amplification in M. smegmatis mc²155, recombinant phages were used to infect Mbv wild type and hygromycin resistant Mbv ΔMPB70 transductants were selected. In the deletion mutant complementation was achieved by expression of the wild type mpb70 gene from the replicating plasmid pEW70c2 (Mbv ΔMBP70::MBP70). In Mtb-H37Rv, mpt70 from H37Rv was inserted in the plasmid pGM221-1. MPT70 constitutive expression is under the control of the hsp60 promoter from the mycobacterial replicative plasmid pGM221-1 (S5E Fig and S3 Table).

For PCR analysis, the bacteria were grown in 7H9 media containing 50 μg/ml hygromycin for Mbv ΔMPB70 cultures, and 50 μg/ml hygromycin and 25 μg/ml kanamycin for Mbv-Compl cultures. DNA for PCR analysis was collected through crude DNA extraction. PCRs were performed with the Phusion High-Fidelity DNA polymerase from NEB, using the Phusion GC Buffer. The primers listed below were used to ascertain the presence of dipZ and/or mpb70 genes (S5A–S5C Fig) List of primers: dipZ-Forw: GAATTACCACGCCAAAGACG; dipZ-Rev: TCATCCGTAGGTGAAGGAAAA; dipZ-mpb70-intergenic-Forw: GCTCCGAAGAAATCATGTCG; mpb70-5’end-Rev: AGACAGCCACCGCCAGAG; mpb70-Rev: CTGCGACATTCCCTGCAC.

The bacteria were grown in Sauton’s media with antibiotics added as appropriate (described above). The supernatant of each strain was collected and concentrated with Amicon Ultra-15 Centrifugal Filter Units. Protein concentrations were then determined using a Pierce BCA Protein Assay kit and the supernatants were diluted to get a normalised whole protein load per well for gel electrophoresis of 25 μg. After transfer of the proteins to the membrane, the membrane was probed using a mouse anti-MPB70 IgG, and an anti-mouse HRP-conjugated (S5D and S5F Fig).