DNA extraction and 16S rRNA V3-V4 gene sequencing

Microbiota sequencing was performed targeting the V3-V4 region of the 16S rRNA genes using the Illumina MiSeq platform. DNA was extracted according to the instructions of the OMEGA E.Z.N. ATM Mag-Bind Soil DNA Kit. DNA integrity was detected by agarose gel electrophoresis. The V3-V4 region of the 16S rRNA genes was amplified by polymerase chain reaction (PCR) with a universal forward primer and unique barcode primer [30] (V3-341F: CCCTACACGACGCTCTTCCGATCTG (barcode) CCTACGGGNGGCWGCAG; V4-805R: GACTGGAGTTCCTTGGCACCCGAGAATTCCA (barcode) GACTACHVGGGTATCTAATCC).

The first amplification was performed under the following conditions: 3 min of denaturation at 94 °C; 5 cycles of denaturation at 94 °C for 30 s, annealing at 45 °C for 20 s, and elongation at 65 °C for 30 s; 20 cycles of denaturation at 94 °C for 20 s, annealing at 55 °C for 20 s, and elongation at 72 °C for 30 s; and a final extension at 72 °C for 10 min. Illumina bridge PCR compatible primers were introduced in the second amplification as follows: 3 min of denaturation at 95 °C; 5 cycles of denaturation at 94 °C for 20 s, annealing at 55 °C for 20 s, and elongation at 72 °C for 30 s; and a final extension at 72 °C for 10 min. Amplicons were purified using AMPure XP beads, and DNA quantitation was performed using a Qubit 3.0 DNA Kit, 10 ng of DNA extracted from each sample was sequenced using the Illumina MiSeq 2 × 300 bp platform.

Raw data were processed as follows: remove joint sequences of primers, splicing sequences according to the overlap, identify sample data by barcode and remove chimeras and nonspecific sequences to achieve quality control. Operational taxonomic unit (OTU) clustering was performed at a 97% similarity level. Software used: Cutadapt, PEAR [31], Prinseq [32], Usearch [33] and Uchime [34].