Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax, Life Technologies) (n = 4 donors for all siRNA experiments). Knockdown efficiency was established by determining mannose receptor expression by microscopy using CD206-Alexa-488 staining (described above) in the small non-granular macrophage sub-population by merging bright field and mannose receptor fluorescence staining. Knockdown efficiency was typically 65–85% (Supplementary Fig. 6c).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.