siRNA knockdown of mannose receptor

HC Huan Cao
AA Aristotelis Antonopoulos
SH Sadie Henderson
HW Heather Wassall
JB John Brewin
AM Alanna Masson
JS Jenna Shepherd
GK Gabriela Konieczny
BP Bhinal Patel
MW Maria-Louise Williams
AD Adam Davie
MF Megan A. Forrester
LH Lindsay Hall
BM Beverley Minter
DT Dimitris Tampakis
MM Michael Moss
CL Charlotte Lennon
WP Wendy Pickford
LE Lars Erwig
BR Beverley Robertson
AD Anne Dell
GB Gordon D. Brown
HW Heather M. Wilson
DR David C. Rees
SH Stuart M. Haslam
JR J. Alexandra Rowe
RB Robert N. Barker
MV Mark A. Vickers
request Request a Protocol
ask Ask a question
Favorite

Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax, Life Technologies) (n = 4 donors for all siRNA experiments). Knockdown efficiency was established by determining mannose receptor expression by microscopy using CD206-Alexa-488 staining (described above) in the small non-granular macrophage sub-population by merging bright field and mannose receptor fluorescence staining. Knockdown efficiency was typically 65–85% (Supplementary Fig. 6c).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A