ChIP-qPCR and ChIP-seq Analysis

ChIP using BALL antibody was performed with 3 × 10⁷ Drosophila S2 cells. Primer sequences used for qPCR analysis have been described previously (Umer et al., 2019). Sequences of IR-1 and IR-2 primers are as follows: IR-1 Forward (CCGAACATGAGACATGGAAAA), IR-1 Reverse (AAAGTGCCGACAATGCAGTTA), IR-2 Forward (CAGTTGATGGGATGAATTTGG), and IR-2 Reverse (TGCCTGTGGTTCTATCCAAAC). 1 × 10⁷ D.Mel-2 cells were incubated with 10 μg/ml dsRNA for 4 days followed by anti-H2A-ubi ChIP as described previously (Umer et al., 2019). For ChIP-Seq, 3 × 10⁷ Drosophila S2 cells were used for ChIP as described above. High throughput sequencing of DNA libraries from ChIP DNA was performed using BGISEQ-500 at BGI Genomics Co., Ltd. Low quality reads and the adaptor sequences were trimmed using BGI SOAPnuke filter (Drmanac et al., 2010; Huang et al., 2017). The sequencing data was uploaded to the Galaxy web public server at³ for analysis (Jalili et al., 2020). The filtered data was mapped to Drosophila genome (dm6) using Bowtie version 2 at default parameters (Langmead et al., 2009). Peak calling was performed using MACS version 2 with 200 bp read extension and 0.05 minimum FDR (q-value) cut-off for peak detection (Zhang et al., 2008). List of annotated peaks was extracted from peak file using ChIPseeker (Yu et al., 2015). Genome-wide binding profiles for BALL ChIP-seq replicates were generated using the “bamCompare” tool with a bin size of 50. Heat map of the BALL binding profile was generated using the “computeMatrix” and “plotHeatmap” deepTools (Ramírez et al., 2016). Sequencing data have been submitted to the GEO under the accession number ({"type":"entrez-geo","attrs":{"text":"GSE165685","term_id":"165685","extlink":"1"}}GSE165685). ChIP-seq data of H3K4me3, H3K27ac, H3K27me3, and TRX were taken from {"type":"entrez-geo","attrs":{"text":"GSE81795","term_id":"81795","extlink":"1"}}GSE81795 (Rickels et al., 2016) while PC ChIP-seq data was downloaded from {"type":"entrez-geo","attrs":{"text":"GSE66183","term_id":"66183","extlink":"1"}}GSE66183 (Kang et al., 2015).