Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Construct

SC Siyu Chen
NZ Na Zhang
GZ Ganghua Zhou
SH Saddam Hussain
SA Sajjad Ahmed
HT Hainan Tian
SW Shucai Wang
request Request a Protocol
ask Ask a question
Favorite

CRISPR/Cas9 genome editing construct for AITR3 and AITR4 editing was generated using the pHEE401E vector. Appropriate target sites on the genome sequences of the single exon of AITR3 and AITR4 were identify on CRISPRscan (www.crisprscan.org), and then evaluated on Cas-OFFinder (www.rgenome.net/cas-offinder/). The target sequences used for AITR3 and AITR4 editing were 5’-GGGTAAACCGGGCCTACCGG(AGG)-3’, and 5’- TGGTTAACGAGGCTTACCGG(AGG)-3’, respectively. The CRISPR/Cas9 construct was generated by following a procedure described previously [61]. The primers used to insert the target sequences into the pHEE401E vector were, AITR3-DT1-BsF, 5’-ATATATGGTCTCGATTGGGTAAACCGGGCCTACCGGGTT-3’, AITR3-DTI-F0, 5’-TGGGTAAACCGGGCCTACCGGGTTTTAGAGCTAGAAATAGC-3’, AITR4-DT2-R0, 5-AACCCGGTAAGCCTCGTTAACCCAATCTCTTAGTCGACTCTAC-3’, and AITR4-DT2-BsR, 5’-ATTATTGGTCTCGAAACCCGGTAAGCCTCGTTAACCC-3’. The U626-IDF and U629-IDR primers used for clone PCR and sequencing of the sgRNA expression cassette in the CRISPR/Cas9 construct were described previously [62].

Copyright and License information: The Author(s) ©2021
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A