CRISPR/Cas9 genome editing construct for AITR3 and AITR4 editing was generated using the pHEE401E vector. Appropriate target sites on the genome sequences of the single exon of AITR3 and AITR4 were identify on CRISPRscan (www.crisprscan.org), and then evaluated on Cas-OFFinder (www.rgenome.net/cas-offinder/). The target sequences used for AITR3 and AITR4 editing were 5’-GGGTAAACCGGGCCTACCGG(AGG)-3’, and 5’- TGGTTAACGAGGCTTACCGG(AGG)-3’, respectively. The CRISPR/Cas9 construct was generated by following a procedure described previously [61]. The primers used to insert the target sequences into the pHEE401E vector were, AITR3-DT1-BsF, 5’-ATATATGGTCTCGATTGGGTAAACCGGGCCTACCGGGTT-3’, AITR3-DTI-F0, 5’-TGGGTAAACCGGGCCTACCGGGTTTTAGAGCTAGAAATAGC-3’, AITR4-DT2-R0, 5-AACCCGGTAAGCCTCGTTAACCCAATCTCTTAGTCGACTCTAC-3’, and AITR4-DT2-BsR, 5’-ATTATTGGTCTCGAAACCCGGTAAGCCTCGTTAACCC-3’. The U626-IDF and U629-IDR primers used for clone PCR and sequencing of the sgRNA expression cassette in the CRISPR/Cas9 construct were described previously [62].
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.