TREC analysis

Real-time qPCR targeting a specific marker of functional T cells, the TREC, was performed as described previously⁴³. Briefly, DNA was extracted from CD3+, CD4+, and/or CD8+ T cell subsets and subjected to a multiplex qPCR to amplify TRECs and the RNaseP housekeeping gene (Supplementary Table ⁸). By reference to standard curves, generated with a TREC-containing plasmid⁴⁴ and dilutions of genomic DNA for the RNaseP gene, TREC numbers were calculated for each sample.

Forward and reverse primers targeting δRec-ΨJα TREC-specific sequences were used to generate a 93-bp amplicon spanning the splice junction, with the TREC probe located just downstream from the junction. The qPCR included primers and probe for an attenuated amplification of the RNase P gene RPPH1. The 20-μL reaction consisted of 10 μL TaqMan^® Fast Universal PCR Master Mix (4367846; Applied Biosystems), 0.4 μL TaqMan RNase P Vic Control Reagent (4316844; Applied Biosystems), and TREC primers and probe sequences (Applied Biosystems) located within the gene identified by accession number [{"type":"entrez-nucleotide","attrs":{"text":"NT_026437","term_id":"568802206","term_text":"NT_026437"}}NT_026437, nucleotides (forward primer) 3944229 through 3944289, and (reverse primer) 3855229 through 3855280] in the following concentrations: 8 pmol each of forward TREC primer (TGCTGACACCTCTGGTTTTTGTAA) and reverse TREC primer (GTGCCAGCTGCAGGGTTTAG), 3 pmol TREC-specific hydrolysis probe (6FAM-ATGCATAGGCACCTGC-MGB), and 5 μL of DNA eluate. Absolute qPCR was performed in an Applied Biosystems 7900 HT Real-Time PCR System in a 384-well plate (4343814; Applied Biosystems).