Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Request a Protocol
Ask a
question
Favorite
RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) was performed using the GeneRacer KitTM as previously described (Michaloski et al., 2006). Total olfactory mucosa RNA was purified from C57BL/6 using TRIzol (Invitrogen, Cat. No. 15596026), following the user guide workflow. The following primers were used to amplify the Olfr17 gene 5′-UTR: P2_R: TCCTGGAGTATCAGAGTACTC and P2_R_NESTED: CAGAGCAAGAGTCAGCTGTAG.
Copyright and License information: ©2021 Leme Silva, Nagai, Nakahara and Malnic.
This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
