2.1. Mice and genotyping strategies

By crossing the Nbs1 ^f/f mice with Vav‐Cre transgenic mice, 37 , 41 we generated Nbs1 ^f/f Vav‐Cre⁺ mice, designated as Nbs1‐HSCΔ. Since mice with at least one intact Nbs1 allele (Nbs1 ^f/+ Vav‐Cre⁺) did not show any defect in embryonic haematopoiesis (Figure S1A‐D), mice with genotypes of Nbs1 ^+/+ Vav‐Cre⁺, Nbs1 ^+/+ Vav‐Cre^‐, Nbs1 ^f/+ Vav‐Cre⁺, Nbs1 ^f/+ Vav‐Cre^‐ and Nbs1 ^f/f Vav‐Cre^‐ are grouped as the controls (Co). Additionally, Nbs1 ^f/+ Vav‐Cre⁺ mice were crossed with p53 knockout mice to generate Nbs1‐HSCΔ; p53^‐/‐ mice (Nbs1/p53‐HSCΔ). 39 All animals were maintained under specific pathogen‐free conditions. Animal care and experiments were performed in accordance with the ethics committee guideline. For the Nbs1 loci genotyping, three primers were used to identify wild‐type allele, Nbs1 ^F allele (0.3kb) and Nbs1 deleted (∆) allele (0.6kb) 39 : loxPtestR, 5′‐AATACAGTGACTCCTGGAGG‐3′; Intron5F, 5′‐ATAAGACAGTCACCACTGCG‐3′; Exon6, 5′‐CAGGGCGACATGAAAGAAAAC‐3′. p53 knockout allele was detected by PCR using the following primers 39 : X7, 5′‐TATACTCAGAGCCGGCCT‐3′; X6.5, 5′‐ACAGCGTGGTGGTACCTTAT‐3′; Neo, 5′‐CATTCAGGACATAGCGTTGG‐3′. The Vav‐cre transgene genotyping was conducted with the primer set: vav‐1, 5′‐GCCTGCCCTCCCTGTGGATGCCACCT‐3′; vav‐2, 5′‐GTGGCAGAAGGGGCAGCCACACCATT‐3′.