Fecal DNA Extraction and 16S rRNA Gene Amplicon Sequencing and Bioinformatics

Fecal samples were collected directly from mice into individually labelled tubes in sterile conditions. The samples were immediately snap frozen in liquid nitrogen and stored at −80°C. Extraction of fecal DNA was performed using the Isolate II Genomic DNA Kit (Bioline, USA) in accordance with manufacture’s protocol. PCR (30 cycles), using 50 ng of fecal-derived DNA as template, was performed using Q5 DNA polymerase (New England BioLabs) with a primer set selected to amplify the V3–V4 region of the gene encoding the 16S rRNA (forward: ACTCCTACGGGAGGCAGCAG; and reverse: GGACTACHVGGGTWTCTAAT). The 16S rRNA gene primers also included additional barcode and spacer sequences and sequences to adapt the amplicons to Illumina sequencing, following the method of Fadrosh et al. (17). Equal quantities of each amplicon were pooled, and sequencing was performed on an Illumina MiSeq (2 × 300 bp), following the manufacturer’s protocol. Data analysis was performed using QIIME 1.9.1 software (18), and sequences were joined using the fastq-join method. The maximum allowed percentage difference within the overlapping region was zero. Sequences were de-multiplexed using the QIIME split library protocol, keeping only sequences with a Phred quality score >20. The data set was inspected for chimeric sequences using Pintail (19). Operational taxonomic units (OTUs) were picked using the UCLUST algorithm (20), and the taxonomy was assigned against the GreeneGene database (21). OTUs were picked at 97% similarity cut-off, and OTUs with less than 0.01% abundance and those assigned to Cyanobacteria were filtered out. Further data analysis was done using Calypso (22). Other than UniFrac and alpha diversity measures that used rarefied data, all statistical analysis was carried out using the OTU table that was log 2 transformed and Cumulative Sum Scaling (CSS) normalized (23).