Lentivirus Package and Transfection

The plasmids, Control, THBS1-SH1 (CCGAAAGGGACGATGACTATG), THBS1-SH2 (CTATGCTATCACAACGGAGTT), THBS1-SH3 (TGACATCAGTGAGACCGATTT), psPAX2, and pMD2.G were extracted using the E.Z.N.A. Endo-free Plasmid Maxi Kit, and their concentrations were measured using the NanoDrop 2000. HEK-293T cells were seeded at a density of 5 × 10⁶ cells/ml in a six-well culture plate (NUNC, Thermo scientific, USA) and incubated at 37°C with 5% CO₂. After overnight incubation, the medium was changed to serum-free DMEM, and then the transfection was performed with the following cocktail for each transfection in sterilized 1.5-ml tubes: 2 μg OF pLKOG/pLKOshRNA plasmid, 1.4 μg of psPAX2 packaging plasmid, and 0.6 μg of pMD2.G envelope plasmid to 200 μl of serum-free DMEM medium. Next, 5 μl of Turbofect transfection reagent (Thermo Scientific, USA) was added to each tube. After incubating for 20 min, the mixture was added dropwise to each well and incubated at 37°C in a 5% CO₂ incubator. After 4–6 h, the medium was gently changed to DMEM + 10% FBS without antibiotics medium. After overnight culture, 0.5 ml of DMEM + 10% FBS medium without antibiotics was added to each well. After 24 h, the medium was harvested from the cells and filtered through a 0.45-μm filter to remove the cells.

HK-2 cells were seeded at a density of 1.0 × 10⁵ cells/ml in 48-well plates for lentivirus infection. The original medium containing the lentivirus was added to the HK-2 cells. After 6 h, the medium was replaced with growth medium. The cells were cultured for 48 h. Then, the cells were cultured with medium containing 10 μg/ml puromycin (sc-108071, Santa, USA) for 2 days. Finally, the positive cells were collected for further study.