Fluorescent in situ hybridization (FISH) and immunofluorescence microscopy

Fluorescence in situ hybridization (FISH) staining was done using DNA specific probes against IL6 (GTAACATGTGTGAAAGCAGCAAAGAGGCACTGGCAGAAAACAACCTGAAC, 5′ labelled with Alexa546, IDT) at a dilution of 1:500 in 60% formamide hybridization buffer as previously described [81]. Samples were mounted on Fluoromount with 4’,6-diamidino-2-phenylindole (DAPI) (Southern Biotechnologies, Birmingham, AL, USA). Immunofluorescence staining was performed as previously described [81,82] using antibody against RanGAP1 (mouse monoclonal, 1:250 dilution, Santa Cruz), RanBP2 (rabbit polyclonal, 1:1000 dilution, Abcam), FLAG (M2 mouse monoclonal, 1:1000 dilution, Sigma) and a secondary antibodies (Alexa647/Alexa568/Alexa488-conjugated donkey anti-mouse/rabbit polyclonal; 1:1000; Life Technologies, Carlsbad, CA, USA). Microscopy, imaging, nuclear mRNA export quantifications and protein nuclear/cytoplasmic distribution quantifications were performed as previously described [5,12,81]. An epifluorescence microscope on a TI-E inverted Nikon microscope using a 60X phase 2, oil objective and a Coolsnap HQ2 14 bit CCD camera (photometric, Tucson, AZ, USA) controlled using NIS elements Basic Research Microscope Imaging Software (2009) was used to capture all the images. Image exposures varied from 30 ms to 2 s. Data pertaining to total integrated intensity, cytoplasmic/total, and nuclear/total fluorescence intensity was calculated as previously described [81] from raw, unprocessed images. Images shown in figures were adjusted for brightness and contrast using the Photoshop (Adobe).