Membrane Yeast Two-Hybrid (MYTH) Screen Assay

A full open reading frame (ORF) of Cry1Ac was PCR-amplified from Bt HD73 plasmids, using the gene-specific primers pBT3-N-Cry1Ac (forward: ATCGAATTCCTGCAG GGCCATTACGGCCATGGATAACAATCCGAACATC; reverse: TACTTACCATGGGGCCGAGGCGGCCCTATTCCTCCATAAG GAGTAATTCC; with the SfiI restriction site). After the SfiI digestion of the PCR products, Cry1Ac was cloned into the bait vector pBT3-N (DUALsystems BioTech). HaCAN was cloned into expression vector pPR3-N (Figure 4B), the construction of HaCAN was prepared in our previous study, and it had been shown that pPR3-N-CAN can express in yeast cells and work well (Wei et al., 2019a).

The interactions between Cry1Ac and HaCAN based on yeast two-hybrid system. Diagrammatic representation of the bait (A) and prey (B) constructs. SD/-LT/X (SD-leucine-tryptophan + 40 mg/L X-Gal media) (X-Gal soluted in N,N-dimethylformamide), SD/-LTH/X (SD-leucine-tryptophan-histidine + 40 mg/L X-Gal media), SD/-LTHA/X (SD-leucine-tryptophan-histidine-adenine + 40 mg/L X-Gal media), and SD/-LTHA/X/10mM3-AT (SD-leucine-tryptophan-histidine-adenine + 40 mg/L X-Gal media + 10 mM 3-AT) plates, respectively. (C) Representative growth of NMY51 yeast cells co-transformed with one of the seven pairs of prey and bait constructs on four SD medium plates with increasing selection stringency. The treatment of pTSU2-APP and pNubG-Fe65 was positive control. The treatment of pBT3-N-Cry1Ac and pPR3-N was negative control.

Four treatments were introduced into competent cells of the Yeast strain NMY51 (DUAL systems BioTech) with lithium acetate (LiAc)/PEG-mediated transformation, including 100 ng pTSU2-APP and 100 ng pNubG-Fe65, 100 ng pBT3-N-Cry1Ac and 100 ng pOst1-NubI, 100 ng pBT3-N-Cry1Ac and 100 ng pPR3-N, and 100 ng pBT3-N-Cry1Ac and 100 ng pPR3-N-HaCAN. The detail of co-transformation method followed the previous description (Wei et al., 2019a). Then, the interaction pairs were screened on four SD (Synthetic Defined Drop-out Medium) plates as the previous description (Wei et al., 2019a). Finally, we photographed the colonies of each prey and bait construct pair on the above four plates.