Illumina library preparation and sequencing

DNA and RNA libraries were constructed independently for each clinical sample. For DNA libraries, we used a Tn5 transposase-based tagmentation method (TruePrep DNA Library Prep Kit V2 for Illumina, TD503-02, Vazyme Biotech Co., Ltd.) followed by PCR (13–16 cycles) with indexed primers (TruePrep Index Kit V2, Vazyme Biotech Co., Ltd.). For RNA libraries, we initially used the commercial SMARTer Universal Low Input RNA Kit (TaKaRa) to test its efficiency in cDNA library construction based on the template switching mechanism. We then developed our own SMARTer-seq protocol by modifying the SMART-seq2 protocol¹⁷. Briefly, 4 μL of TNA was mixed with 0.5 μL of SMARTer RT primer (10 μM, 5′- ACACTCTTTCCCTACACGACGCNNNNNN-3′), 2 μL of 5 × Maxima H Minus RT Buffer, 1 μL of MgSO4 (100 mM) and 0.25 µL of Recombinant RNase Inhibitor (40 U/μL, TaKaRa), denatured at 65 °C for 5 min and then immediately placed on ice. Then, 1 μL of dNTP mix (10 mM), 0.5 µL of TSO (20 μM; ACACTCTTTCCCTACACGACGCrGrG + G, where rG represents ribonucleotide, and + G represents locked nucleic acid), 0.5 µL of Maxima H Minus Reverse Transcriptase (200 U/μL, Thermo Fisher) and 0.25 µL of RNase Inhibitor were added. Reverse transcription was carried out by incubating at 25 °C for 10 min and 50 °C for 30 min, followed by inactivation by incubation at 85 °C for 5 min. The volume after first-strand cDNA synthesis was 10 μL. Then, 8 μL of first-strand cDNA was used for PCR amplification. Twenty microlitres of 2 × Phanta Max Master Mix (Vazyme Biotech Co., Ltd.), 0.2 μL of SINGV PCR primer (10 μM, 5′- ACACTCTTTCCCTACACGACGC -3′) and 11.8 μL of nuclease-free water were added to a final reaction volume of 40 μL. The reaction was incubated at 95 °C for 3 min and then cycled 25 times as follows: 95 °C for 20 s, 67 °C for 15 s, and 72 °C for 2 min. PCR products were purified using a 1:1 ratio (v/v) of VAHTS DNA Clean Beads (Vazyme Biotech C., Ltd), with the final elution performed in 20 μL of nuclease-free water. The extracted DNA products were quantified using the ds DNA HS Assay Kit (Thermo Fisher) on a Qubit 3.0 Fluorometer (Thermo Fisher). Approximately 5 ng of amplified product was used for library construction using the TruePrep DNA Library Prep Kit V2 for Illumina (TD503-02, Vazyme Biotech Co., Ltd.). The amplified product (13–15 cycles) was purified using AMPure XP beads. Sequencing was performed on a NovaSeq 6000 with a 2 × 150-bp paired-end sequencing protocol, and 10 to 150 million reads were generated for each sample. For each batch of samples, a pure water control or optionally a negative sample control (specific pathogen free) was included and analysed in parallel.