Osteogenic Differentiation Analysis by Quantitative Real Time-PCR

Total RNA was extracted from hMB-MSC using Trizol-LS (Invitrogen 15596018). Differentiated cells were washed with PBS and 200 μl of Trizol-LS were added and mechanical lysis was performed for 5 min at RT. Two hundred microliters chloroform was added to each well and samples were centrifuged at 12,000 g at 4°C during 15 min. The aqueous phase was recovered and 500 μl of isopropanol 99.9% were added. Tubes were incubated 10 min at 4°C and centrifuged at 12,000 g and 4°C for 15 min. Pellet was rinsed with 500 μl ethanol 75% and centrifuged at 7,500 g and 4°C for 5 min. Pellet was dried and suspended in RNAse and DNAse free water. 500 ng/μl of RNA was used to cDNA synthesis following the manufacturer's instruction of SuperScript III Reverse Transcriptase (ThermoFisher 18080044). This cDNA was used as a template in reactions using the kit SensiFAST SYBR No-ROX (Bioline, BIO-98005), according to the manufacturer's instruction. The reaction was carried out in a program of 95°C for 2 min and then cycled 39 times at 95°C for 15 s, 62°C for 30 s and 72°C for 20s. The assays were performed in three technical replicates. The following primers were used for Alkaline phosphatase (ALPL) gen: forward 5′-CCCGCTTTAACCAGTGCAAC-3′; reverse 5′-GAGCTGCGTAGCGATGTCC-3′ (Hu et al., 2015). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (forward 5′-CAGAGTTAAAAGCAGCCCTGGT-3, reverse 5′ GAAGGTGAAGGTCGGAGTCAAC−3′) was used as a housekeeping gene for the normalization of data. The fold changes in mRNA expression were calculated by normalization of the cycle threshold (C_t) value of target genes. The Ct cut-off was 40. Statistical analyses were performed using GraphPad Prism (One-way ANOVA).