Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

Construction of recombinant baculoviruses.

HC Han Chen
JL Jessica L. Lawler
DF David J. Filman
JH James M. Hogle
DC Donald M. Coen
request Request a Protocol
ask Ask a question
Favorite

Recombinant baculoviruses used to express WT Pol and A987G Pol were constructed using bacmids and methods described previously (14). Primers used for site-directed mutagenesis of plasmid pGST-WT Pol to generate the plasmid for glutathione S-transferase (GST)-tagged HCMV Pol mutant A987G were purchased from Integrated DNA Technologies: CTGGTGCGCAAGACGGGCTGCGAGT (forward) and CTTGACGAACTCGCAGCCCGTCTTGC (reverse).

Copyright and License information:  ©2021 Chen et al.
This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the Creative Commons Attribution 4.0 International license.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A