m6A‐miCLIP

miCLIP was performed following previously described method (Linder et al, 2015) using 10 μg of purified mRNA from Drosophila S2R⁺ cells and 5 μg of anti‐m⁶A antibody (Synaptic Systems, Lot# 202003/2‐82). Immunoprecipitations were performed in quadruplicates, and as a control, one immunoprecipitation was performed where UV‐crosslinking was omitted. Of note, this sample produced a library of limited complexity, reflecting a low amount of background mRNA binding. Briefly, total RNA was isolated using Trizol reagent (Invitrogen) and DNA was removed with DNase‐I treatment (NEB). Polyadenylated RNA was purified by two rounds of binding to Oligo (dT)25 magnetic beads (NEB), and mRNA was fragmented with RNA fragmentation solution (Ambion) using 1 μl of solution per 2 μg of mRNA and with 7‐min incubation at 70°C. Immunoprecipitation was performed at 4°C in 500 μl of binding buffer (BB) (50 mM Tris–HCl pH 7.4, 150 mM NaCl, 0,5 % NP‐40). First, isolated mRNA and antibody were incubated for 2 h. Samples were then transferred to individual well of a 12‐well cell culture plate and crosslinked on ice (two times at 150 mJ/cm²). Next, 60 μl of magnetic ProteinG beads (Invitrogen) was resuspended in 500 μl of BB and added to the IP sample. Samples were then incubated for additional 2 h at 4°C, before washing with ice‐cold solutions was performed: 1x with BB, 2x with high salt buffer (50 mM Tris–HCl pH 7.4, 1 M NaCl, 1% NP‐40, 0,1% SDS), 1x BB , 2x with PNK buffer (20 mM Tris–HCl pH 7.4, 10 mM MgCl₂, 0,2% Tween). All washes were performed by gentle pipetting and with 1‐min incubation on ice. Washes with HSB were additionally rotated for 2 min at 4°C. Finally, beads were resuspended in 900 μl of PNK buffer. Forty μl was used for WB analysis to evaluate immunoprecipitation efficiency. Remaining 860 μl was used for library preparation. All steps of library preparation were performed as previously described in (Sutandy et al, 2016). Libraries were sequenced on an Illumina NextSeq500.

For the miCLIP fragmented input control library, fragmented mRNA, that was also used for miCLIP IP, was first purified using the 1.8× volume of RNAClean XP beads (Beckman Coulter). Following the 20‐min incubation at RT, captured RNA was washed 3x with 80% EtOH and eluted in 20 μl of RNase‐free water. The library was prepared using ~ 50 ng of cleaned, fragmented mRNA using the NEBNext Ultra Directional RNA Library Prep Kit for Illumina (NEB), by omitting the RNA fragmentation step and following the manufacturer`s protocol. For library amplification, 11 PCR cycles were used and indicated primer and adaptor sequences: NEBNext Index 27 Primer for Illumina: 5´‐CAAGCAGAAGACGGCATACGAGATAAAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC‐s‐T‐3´ (Expected index read: ATTCCT), NEBNext Adaptor for Illumina: 5´‐/5Phos/GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT CUA CAC TCT TTC CCT ACA CGA CGC TCT TCC GAT C‐s‐T‐3´. Libraries were sequenced on an Illumina NextSeq500.