Improve Research Reproducibility A Bio-protocol resource
- Home
- Protocols
-
Concise Method
Chromatin Immunoprecipitation (ChIP) Assays
Ask a
question
Favorite
ChIP assays were performed as described previously.32 All data are expressed as the means ± SD of at least three experiments. Notch1 promoter fragments were amplified using DRE1 Primer 1(5ʹ GAC CCGTTTGTGCTTTCTG 3ʹ) and DRE1 Primer 2 (5ʹ GACACGCTCCTCGGTCAC 3ʹ), and DRE2 Primer 1 (5ʹ GCAAATTTCAGTCGCCAGTT 3ʹ) and DRE2 Primer 2 (5ʹ GCGCCTGGGACTACTTCTC 3ʹ).
Copyright and License information: ©2021 Liu et al.
This work is published and licensed by Dove Medical Press Limited. The full terms of this license are available at https://www.dovepress.com/terms.php and incorporate the Creative Commons Attribution – Non Commercial (unported, v3.0) License (http://creativecommons.org/licenses/by-nc/3.0/). By accessing the work you hereby accept the Terms. Non-commercial uses of the work are permitted without any further permission from Dove Medical Press Limited, provided the work is properly attributed. For permission for commercial use of this work, please see paragraphs 4.2 and 5 of our Terms (https://www.dovepress.com/terms.php).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Post a Question0 Q&A
