Improve Research Reproducibility A Bio-protocol resource
Concise Method
tooltip

T7E1 assay

MY Mi-Hyeon You
MJ Min Ji Jeon
SK Seong ryeong Kim
WL Woo Kyung Lee
SC Sheue-yann Cheng
GJ Goo Jang
TK Tae Yong Kim
WK Won Bae Kim
YS Young Kee Shong
WK Won Gu Kim
request Request a Protocol
ask Ask a question
Favorite

Genomic DNA was extracted using a DNA Extraction Kit (DNeasy Blood & Tissue Kit, QLAGEN) after 2 days of transfection. CRISPR-Cas9 target sites were amplified using primer pairs (Exon 4, Forward: GAACCAGCTTCAGAACCAGGC and Reverse: GCTGGAAGCTCATTACAGCC; Exon 5, Forward: GGAGACAGACAGACAGTCTC and Reverse: CTGTGGAGGTGAATGGGAGAC) by PCR. The PCR was progressed under the condition (94 °C for 5 min, 35–40 cycles of 94 °C for 20 s/57 °C for 30 s/72 °C for 35 s, and 72 °C for 5 min). T7E1 analysis was performed. The amplicons were denatured by heating and annealed to form heteroduplex DNA, which was treated with 5 units of T7 endonuclease 1 (Toolgen Inc., Seoul, Korea) for 20 min at 37 °C and then analyzed by electrophoresis on a 1.5% agarose gel.

Copyright and License information: The Author(s) ©2021
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A