The cis-elements GCC-box (AGTGCCAAAAGCCGCCACACCCCT) and mGCC-box (AGTGCCAAAATCCACTACACCCCT) were inserted into pABAi vector as reporters, respectively. The reporters were linearized using restriction enzyme BbsI and transformed into Y1H gold strain. FtAP2YT1Pro and FtAP2YT1Ala were inserted into pGADT7 vector containing a GAL4 transcriptional activation domain as effectors, respectively. The effectors were transformed into the Y1H gold strain containing the reporter gene, respectively. Transformants were plated on minimal synthetic defined (SD)-glucose medium lacking Leu (-L) and selected on SD-L medium with Aureobasidin A. Y1H assay was performed according to the manufacturer’s protocol (Matchmaker One-Hybrid System; Clontech; http://www.clontech.com/).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.