Yeast one hybrid (Y1H)

KZ Kaixuan Zhang
MH Ming He
YF Yu Fan
HZ Hui Zhao
BG Bin Gao
KY Keli Yang
FL Faliang Li
YT Yu Tang
QG Qiang Gao
TL Tao Lin
MQ Muriel Quinet
DJ Dagmar Janovská
VM Vladimir Meglič
JK Jacek Kwiatkowski
OR Olga Romanova
NC Nikhil Chrungoo
TS Tatsuro Suzuki
ZL Zlata Luthar
MG Mateja Germ
SW Sun-Hee Woo
MG Milen I. Georgiev
MZ Meiliang Zhou
request Request a Protocol
ask Ask a question
Favorite

The cis-elements GCC-box (AGTGCCAAAAGCCGCCACACCCCT) and mGCC-box (AGTGCCAAAATCCACTACACCCCT) were inserted into pABAi vector as reporters, respectively. The reporters were linearized using restriction enzyme BbsI and transformed into Y1H gold strain. FtAP2YT1Pro and FtAP2YT1Ala were inserted into pGADT7 vector containing a GAL4 transcriptional activation domain as effectors, respectively. The effectors were transformed into the Y1H gold strain containing the reporter gene, respectively. Transformants were plated on minimal synthetic defined (SD)-glucose medium lacking Leu (-L) and selected on SD-L medium with Aureobasidin A. Y1H assay was performed according to the manufacturer’s protocol (Matchmaker One-Hybrid System; Clontech; http://www.clontech.com/).

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

post Post a Question
0 Q&A