Barcode design and transfection

The SBO contains a unique 8–base pair (bp) sample barcode, an amplification handle, and a poly-A tail. 5′-TCCAAGGTACAGACCTCTGACGNNNNNNNN(A)₃₀-3′ is the full SBO sequence. “TCCAAGGTACAGACCTATATCTGACG” is the amplification handle sequence, “NNNNNNNN” is the sample barcode sequence, and (A)₃₀ is the poly-A tail sequence. All SBOs were prepared by IDT (Integrated DNA Technologies, USA) without any modifications. Four hours before Drop-Seq, SBO (28 pmol/ml) was transfected per well using Lipofectamine 3000 (Life Technologies, USA) according to the manufacturer’s protocol.