Establishment of Pin1 KO cell lines using CRISPR/Cas9

Pin1-targeting guides were annealed into the BbsI restriction site of the pX458 plasmid (Addgene cat#48138). The gRNA sequence used was: CAGTGGTGGCAAAAACGGGC. Cells were transfected using the Neon Transfection System (Life Technologies) according to manufacturer guidelines, and GFP+ cells were sorted using fluorescence-activated cell sorting (FACS) using a J AriaII SORP UV machine (BD). Single cell clones were isolated from the bulk-sorted population using limiting dilution plating in a 96-well plate. Once clones were isolated, they were verified for Pin1 knockout by western blotting and by genomic DNA PCR using the following primers: forward: GAGCCTGTGGCACATGGTG, reverse: CAGGGTCAGGTCATGCACTG, sequencing: CTGGCTTCTGGCTGTG, and sequences were analyzed using Tracking of Indels by Decomposition (TIDE)⁵⁰.