Total RNA was extracted from tissues or cultured cells by TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA), after which cDNA was synthesized from 1 μg total RNA using a Reverse Transcription kit (Takara Biotechnology, Shiga, Japan) in accordance with the manufacturer’s instructions. A quantitative PCR was performed with a LightCycler 480 Realtime PCR System (Roche, Mannheim, Germany) using the following protocol: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 30 s. The results were normalized to the expression of β‐actin. The primers used were: ADAMTS7 (forward primer, 5′‐GTGGAGACCCTGGTAGTAGC‐3′ and reverse primer, 5′‐TCTGCGTGGTGCGTGATCTTTA‐3′); BMP2 (forward primer, 5′‐TGACGAGGGTCCTGAGCGA‐3′ and reverse primer, 5′‐CCTGAGTGCCTGCGATACA‐3′); Runx2 (forward primer, 5′‐CTGGTGTCTCGGCTTCAATCT‐3′ and reverse primer, 5′‐TTCAAGGTGCCAAGAGGTAAGT‐3′); Msx2 (forward primer, 5′‐CCGCCTGTGGGACTCTATG‐3′ and reverse primer, 5′‐GGCTGGTACTGCCTTCGTG‐3′); Osteocalcin (OCN) (forward primer, 5′‐AGGGCAGCGAGGTAGTGAA‐3′ and reverse primer, 5′‐TCCTGAAAGCCGATGTGGT‐3′); Osteopontin (OPN) (forward primer, 5′‐AGCAGCAGGAGGAGGCAGAGCACAG‐3′ and reverse primer, 5′‐CTGTGCTCTGCCTCCTCCTGCTGCT‐3′); β‐actin (forward primer, 5′‐ATCTGGCACCACACCTTC‐3′ and reverse primer, 5′‐AGCCAGGTCCAGACGCA‐3′).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.