Mtb Chorismate Synthase Activity Assay

The ability of the aurones to inhibit Mtb-Cs was determined using a coupled enzyme reaction. Mtb-Cs needs Mtb EPSPs for biosynthesis of EPSP, which is the substrate for Cs, and Mtb-Cs for the formation of chorismate.

Mtb EPSP synthase and Cs were over-expressed in Escherichia coli using pET28a(+) and purified from the soluble components of the lysates by affinity chromatography on a HisTrap column via elution with a series of concentrations of imidazole. PCR amplified EPSP (Rv3227) and Cs (Rv2540c) coding sequences were cloned into pET28a(+). PCR was conducted using the primers Rv2540c-F tatacatatggtgttgcgctggatcacc and Rv2540c-R: tataggatccttaaccggagacccgc to amplify Rv2540c from genomic DNA of Mtb CDC1551 with the following program: denaturation for 5 min at 95°C, then 34 cycles consisting of 45 sat 95°C, 45 s at the annealing temperature (56°C), and 3 min at 72°C, and then 10 min at 72°C for final extension. To amplify Rv3227 from genomic DNA of Mtb CDC1551, PCR was conducted using the primers Rv3227-F: tatacatatggtgaagacatggccagcc and Rv3227-R: tataggatccactcgtcgtagtcgccgg with the following program: denaturation for 5 min at 95°C, then 34 cycles consisting of 45 s at 95°C, 45 s at the annealing temperature (62°C), and 3 min at 72°C, and then 10 min at 72°C for final extension. Further PCR-amplified products of Rv2540c and Rv3227 were analyzed on 0.8% agarose gel and purified with the DNA clean & concentrator kit (Zymo research). Eluted purified PCR products and expression vector pET-28a(+) were digested with NdeI and BamHI, respectively. The pET-28a(+) vector was also dephosphorylated by phosphatase. After electrophoresis, DNA bands were excised, and then Rv2540c, Rv3227, and the pET-28a(+) vector were extracted using an Agarose GelExtract Mini Kit (5-PRIME). The digested fragments of Rv2540c and Rv3227 were mixed with the pET-28a(+) vector, respectively, and then ligated with T4 DNA ligase. The ligated product was transformed into chemically competent E. coli DH5α cells and clones were selected on LB agar plates containing 25 μg/mL kanamycin. The cloned Rv2540c and Rv3227 were confirmed by sequencing (Eurofins Genomics). For expression of Rv2540c and Rv3227, the constructed plasmids were isolated and transformed into expression Rosetta (DE3) competent cells (Novagen). Positive transformants were screened on LB agar plates containing 25 μg/mL kanamycin and confirmed by sequencing. The E. coli Rosetta (DE3) strain carrying plasmid Mtb-Cs (Rv2540c) or EPSPs (Rv3227) was induced by IPTG over night at 16°C. After lysis of the E. coli Rosetta (DE3) cells, the rRv2540c and rRv3227 expressed as His-tagged fusion proteins were purified from the soluble components of the lysates by affinity chromatography on a HisTrap HP Ni²⁺ IMAC column eluted with a series of concentrations of imidazole. The samples were analyzed by SDS-PAGE to confirm the size and purity of the proteins.

The synthesis of EPSP was carried out in a vial containing EPSPs (0.7U), shikimate (9.6 mM), and phosphoenolpyruvate (PEP; 3 mM) at 25°C for 30 min. The equilibrium of the forward reaction was displaced using purine nucleoside phosphorylase (PNP, 2U) and 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG, 0.4 mM), which consumes phosphate (Pi), increasing the final concentration of EPSP in the reaction mixture. Cleaved MESG results in an absorbance change from 330 to 360 nM. Thus, EPSP synthesis was monitored by measuring A₃₆₀ using a spectrophotometer.

After EPSP synthesis, the enzymes were removed by ultrafiltration (3 kD cut-off Centricon), and the filtrate was directly used as a source of EPSP for the chorismate synthesis reaction. The reaction of converting EPSP to chorismate and Pi by Cs contained Mtb-Cs, EPSP (15 μL), FMN (0.04 mM), and NADH (0.3 mM). The production of chorismate from the enzymatic reaction was determined by measuring Pi production using MESG (0.2 mM) and PNP (1 U). To assess the aurones effect on Cs, Cs was incubated with various concentrations of the aurone leads in a vial preloaded with EPSP and FMN. After adding NADH into the vial, samples were added into a 96-well plate and mixed with MESG and PNP. The production of chorismate from the enzymatic reaction was indirectly measured by measuring Pi production at A₃₆₀ from the reaction using MESG and PNP. The untreated sample was added to the aurone dilution buffer containing the same concentration of DMSO as those of the aurone-treated samples and served as a positive control (activity 100%). The negative control consisted of the same components as the positive control except that Mtb Cs was replaced with the buffer. The absorbance of the negative control was subtracted from the absorbance of the other samples in data analysis. The enzymatic velocity was calculated as the variation of absorbance per minute.