Nuclear-Import Assay

Nuclear import was assayed with a protocol adapted from yeast.¹¹ A lentiviral vector containing three GFP molecules attached to the SV40 nuclear localization signal (NLS) (pHAGE-EFS-PCP-3XGFPnls) was obtained as gift from Thoru Pederson (Addgene plasmid #75385).¹⁹ To generate GFP constructs with no NLSs and to generate the hnRNPA1 NLS, double-stranded DNA oligos (5′-5Phos/GCCGCCGCCTAA-3′ and 5′-5Phos/TCAAATTTTGGACCCATGAAGGGAGGAAATTTTGGAGGCAGAAGCTCTGGCCCCTATTAA-3′, respectively) were cloned into pHAGE-EFS-PCP-3XGFPnls between the XhoI and XbaI sites. Fibroblasts from individual 1, individual 2, and control individuals were infected with GFP-SV40-NLS, GFP-hnRNPA1-NLS, or GFP-no-NLS virus. It was determined via live-cell imaging that on the sixth day after infection, GFP signal was visible in the cytoplasm and nuclei of infected cells. At this point, cells were incubated with Alexa 555-conjugated wheat germ agglutinin to stain cell membranes (ThermoFisher Scientific) and fixed in 2% paraformaldehyde for immunofluorescence microscopy. 2D images of individual cells were manually captured using a Zeiss LSM 880 laser scanning microscope, and images were quantified using ImageJ software. DAPI was used for defining the nuclei, and wheat germ agglutinin was used for defining the cell boundaries. After background subtraction, total GFP fluorescent intensity was measured in the nuclei and cytoplasm of infected cells and normalized to the respective cell compartment area before calculation of the ratio of nuclear to cytoplasmic GFP intensity.