GFP-expressing virus construction.

We constructed MAV-1 expressing enhanced GFP (eGFP) fused at the C terminus of the minor capsid protein pIX. We first amplified the gene for MAV-1 pIX from pMXD (17) with a 5′ primer (BamLpIX; 5′GCAAGGATCCTTTCTAACATATGAAAGTG3′) that added a BamHI site 5′ of the NdeI site at nucleotide (nt) 2014 (MAV-1 sequence; {"type":"entrez-nucleotide","attrs":{"text":"NC_000942","term_id":"6446580","term_text":"NC_000942"}}NC_000942) and a 3′ primer (ClaH3RpIX; 5′ACGAAAGCTTATCGATATCACTTTCTTCCCCGTT3′) that added ClaI and HindIII sites just before the pIX stop codon, such that the ClaI site followed the last amino acid codon and facilitated the subsequent cloning of eGFP in frame with pIX. This PCR product was digested with NdeI and HindIII and ligated into NdeI- and HindIII-digested pUC8 to create plasmid pUC8pIX. pShuttleIX-EGFP (43), a kind gift of David Curiel (Washington University), was used to amplify the eGFP gene, using a 5′ primer (LR1ClaFLAGGFP; 5′GGAGCAGAATTCATCGATTCTGCCGATTATAAGGATGAC3′) that inserted an EcoRI site and a ClaI site upstream of FLAG-tagged eGFP and a 3′ primer, RSphSal (5′AGTCGTCGACGCATGCATCTTTATTTGGGATCATAACTTGTACAGCTCGTCCAT3′), which includes the sequence from nt 3175 to nt 3195 (SphI site) of MAV-1 followed by a 3′ SalI site. This eGFP product was digested with ClaI and SalI and inserted into ClaI- and SalI-digested pUC8pIX. The resulting plasmid, pUCpIXFGFP, was digested with NdeI and SphI and the smaller fragment inserted into similarly digested pMXD, effectively replacing the wt pIX sequence in pMXD with the pIX-eGFP fusion. This construct, pMXD-FGFPpIX, was verified by DNA sequencing.

We introduced pIX-eGFP into the MAV-1 genome in the region of the pIX gene by bacterial artificial chromosome (BAC) recombineering using GalK selection (44). We amplified the GalK gene from pGalK (44) with a forward primer (MAVL3101; 5′GCACAAGGAGAGGAAGAGGAGGAAGAGGAGGACGGAGCTGAAGACATTGAGCCTGTTGACAATTAATCATCGGCA3′) containing 51 nt of MAV-1 sequence (nt 3101 to 3151) followed by 24 nt of GalK cassette sequence and a reverse primer (MAVL3404; 5′CTGGATCATCTATAACACCTCCCCCGAACATGAATGTATGCAATGGATGTACTCAGCACTGTCCTGCTCCTT3′) containing 52 nt of MAV-1 sequence (nt 3455 to 3404) followed by 20 nt of GalK cassette sequence. The amplified mixture was digested with DpnI to remove methylated plasmid template, and the PCR product was purified. This GalK PCR fragment with 50 bp of MAV-1 sequence flanking each end was introduced by recombineering into Escherichia coli SW102 containing a bacmid that has the entire wt MAV-1 sequence, pKBS2.MAV‑1wt (colony16), which was a kind gift of Silvio Hemmi (University of Zürich). Recombineering protocol 3 (http://ncifrederick.cancer.gov/research/brb/protocol.aspx) was used for this and subsequent recombineering steps. Gal-positive (Gal⁺) colonies that contained the plasmid bacmid GalK gene replacing the pIX gene of the MAV-1 bacmid were identified. One of these colonies (pMAV-1ΔpIX::galK-C) was then used for the replacement substitution step, in which the pIX-eGFP fusion replaced the GalK gene.

To obtain the DNA fragment for the replacement substitution step, pMXD-FGFPpIX was digested with HpaI and PvuI, and the fragment corresponding to MAV-1 nt 2059 to 3700 (with the insertion of FLAG-eGFP at MAV-1 nt 3172) was gel purified. This fragment was introduced into pMAV-1ΔpIX::galK-C by recombineering; selection against the GalK cassette (and thus replacement by the pIX-eGFP gene) was achieved by selecting for resistance to 2-deoxy-galactose. Candidate colonies were identified by BamHI digestion, BAC DNA was purified from two candidate colonies using a Marligen Biosciences PowerPrep HP Plasmid Purification kit, and relevant junctions were verified by DNA sequencing. The MAV-1 genome was released from the bacmid by PmeI digestion, phenol-chloroform extracted, ethanol precipitated, and resuspended in water. The DNA was transfected into CMT-93 cells using FuGENE HD transfection reagent (Roche). Transfected wells were passaged after 1 week when no cytopathic effect (CPE) was visible. A second passage resulted in CPE, and GFP fluorescence was verified by immunofluorescence microscopy. Stocks were prepared from 3×-plaque-purified virus grown on mouse NIH 3T6 cells. The resulting MAV-1 strain with the pIX-eGFP is formally named MAV-1 inp903 and is referred to here descriptively as MAV-1.IXeGFP. MAV-1.IXeGFP stock titers are generally 10-fold lower than wt titers, but the virus has behaved like the wt strain in all assays performed to date (K. R. Spindler, unpublished data).