Quantitative PCR

Total RNA was extracted from whole embryos at E8.5 and bone marrow cells at 2-month-old using Trizol reagent (ambient) and Direct-zol RNA Microprep (Genesee Scientific). cDNA was then reverse-transcribed by using Maxima H Minus cDNA Synthesis Master Mix (Invitrogen, M1662). Real-time PCR was then performed with the following primers using the Powerup SYBR green reagent (Invitrogen, {"type":"entrez-protein","attrs":{"text":"A25777","term_id":"88769","term_text":"pir||A25777"}}A25777) on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific). Gene expression was calculated and expressed relative to a housekeeping gene (Hprt) using the ΔΔCT-method. Cre-forward primer; ACGTTCACCGGCATCAACGT, Cre-reverse; CTGCATTACCGGTCGATGCA, Hprt-forward; GGCTATAAGTTCTTTGCTGACCTG, and Hprt-reverse; AACTTTTATGTCCCCCGTTGA.