CqsR LBD purification

Full length CqsR as well as the region encoding the periplasmic region of CqsR (CqsR-LBD, residues 35–274) were PCR amplified with primer pairs WNTP0207 (ATATACCATGGCTATTCGCTCCTCGCTTAAAAAG) / WNTP0209 (CTCGAATTCGACTCTACCGATGGTAAAGATGGTTC) and WNTP0694 (GCCTGGTGCCGCGCGGCAGCGAAGTCCCATTTAGAAAAGAG) / WNTP695 (GCTTTGTTAGCAGCCGGATCTTAGATGTTGATAATTAAGTCGAAG) respectively from V. cholerae genomic DNA, while the vector pET28B was amplified with primers WNTP692 (GCTGCCGCGCGGCACCAG) and WNTP693 (GATCCGGCTGCTAACAAAG). Each insert was ligated into the plasmid backbone using Gibson assembly (NEB) and the resulting plasmids was sequenced and transformed into E. coli BL21(DE3) strains WN3657 andWN5327 respectively for protein overexpression and purification. MBP-fusions of WT CqsR-LBD and CqsR^D171V-LBD were constructed by amplifying the LBD fragments from gDNA obtained from Vibrio cholerae strains WN3176 and WN5887 respectively using primers WNTP1290 (GGGATCGAGGGAAGGATTTCAGAATTCGAAGTCCCATTTAGAAAAGAGCTGAAAAA) and WNTP1291 (AGCTTGCCTGCAGGTCGACTCTAGATTAGATGTTGATAATTAAGTCGAAGATGATTTCATCGACA) and ligated into EcoRI and XbaI digested pMAL-c2X vector using Gibson assembly. The resulting plasmids were transformed in E. coli S17 λpir strains WN6173 and WN6180 respectively and verified by sequencing.

For CqsR-LBD overexpression, strain WN5327 was grown to OD₆₀₀ ~ 0.5 and CqsR production was induced with 1 mM IPTG at 16 °C overnight. Cells after IPTG induction were collected by centrifugation and resuspended in binding buffer (50mM sodium phosphate buffer, pH 7.0; 300mM sodium chloride; 10mM imidazole, pH 7.7; 5% glycerol). Resuspended cells were then lysed with a fluidizer. Insoluble materials were removed by centrifugation (10000g, 4 °C, 1 hour) and subsequent filtering through a 0.45 μm filter. Cleared lysate was loaded onto His-Trap column (1 mL) equilibrated with binding buffer. The column was then washed with 20 mL binding buffer. Proteins were eluted with binding buffer containing 120 to 300 mM imidazole. Fractions containing CqsR-LBD were pooled and used in the in vitro biochemical assays described below.

For purification of the MBP fusion proteins, E. coli strain WN6173 (WT) or WN6180 (D171V) was grown in LB+0.2% glucose and MBP-CqsR expression was induced by addition of 0.3 mM IPTG for 3 hours at 30 °C. Cell pellet was resuspended in 20 mL ice-cold column buffer (20 mM Tris–HCl, pH 8.0, 200 mM NaCl, 1 mM EDTA, 5% glycerol) and disrupted by fluidizing. Insoluble proteins and cell debris were removed by centrifugation at 10,000 g for 15 min at 4 °C, and supernatants containing the target protein was collected. After filtration through a 0.45 μm filter, the supernatant was loaded into an amylose resin affinity column (NEB, MA, USA) equilibrated with column buffer. After loading, the column was washed with column buffer, then eluted with column buffer containing 10 mM maltose and 1 mL fractions were collected. Fractions were analyzed by SDS-PAGE for protein purity and then stored at − 20 °C for later use.