RNA from ESCC tissues specimens and cells was extracted by using TRIzol reagent (Thermo Fisher Scientific) and reverse‐transcribed using All‐in‐One miRNA Prime ScriptRT reagent kit (Takara, Shiga, Osaka, Japan). QPCR was performed using the qRT‐PCR Detection Kit (GeneCopoeia, Inc., RockVile, MD, USA) and SYBR mix (TaKaRa, Dalian, China) on the 7500 Fast Real‐Time PCR system (Thermo Fisher Scientific). U6 or GAPDH was usage as internal reference gene. Relative expression of TUG1, miR‐148a‐3p, MCL‐1 was calculated by the 2‐ΔΔCt method. The primers were designed and obtained from Sangon Biotech (Shanghai, China), and sequences of primers for TUG1, MCL‐1, GAPDH, miR‐148a‐3p and U6 and used in qPCR reactions were listed: TUG1 forward (5′‐TAGCAGTTCCCCAATCCTTG‐3′), TUG1 reverse (5′‐CACAAATTCCCATCATTCCC‐3′); MCL‐1 forward (5′‐CGGCAGTCGCTGGAGATTAT‐3′), MCL‐1 reverse (5′‐GTGGTGGTGGTTGGTTA‐3′); GAPDH forward (5′‐GAGTCAACGGATTTGGTCGT‐3′), GAPDH reverse (5′‐TTGATTTTGGAGGGATCTCG‐3′); miR‐148a‐3p forward (5′‐TCAGTGCACTACAGAACTTTGT‐3′), miR‐148a‐3p reverse (5′‐GAATACCTCGGACCCTGC‐3′); U6 forward (5′‐CTCGCTTCGGCAGCACA‐3′), U6 reverse (5′‐AACGATTCACGAATTTGCGT‐3′).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.