Rat HSC‐T6 cells, a cell line of human liver fibroblasts (KeyGEN Bio TECH, Nanjing, China), were maintained in Dulbecco's modified Eagle's medium (DMEM, supplemented with 10% foetal bovine serum (FBS), 100 U/ml penicillin and 100 mg/ml streptomycin). HSC‐T6 cells were cultured in DMEM with 10% FBS and incubated in a humidified atmosphere 5% CO2 at 37°C.
Hepatic stellate cell‐T6 cells (2 × 105) were grown to 60%‐80% confluence with antibiotic‐free DMEM in six‐well plates for 12 hours and then transfected with shRNA using Lipofectamine TM2000 (Invitrogen, USA) according to the instructions. Short hairpin RNA (shRNA) oligonucleotides were provided by the Shanghai Gena Pharma Corporation (Shanghai, China) for ASIC1a genes or scrambled sequences. The sequence for ASIC1a RNAi was 5’‐CACCGCCAAGAAGTTCAACAAATCGTTCAAGAGACGATTTGTTGAACTTCTTGGCTTTTTTG‐3’ (forward) and 5’‐GATCCAAAAAAGCCAAGAAGTTCAACAAATCGTCCTTGAACGATTTGTTGAACTTCTTGGC‐3’ (reverse) and the sequence for the control RNAi was 5’‐CACCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG‐3’ (forward) and 5’‐GATCCAAAAAATTCTCCGAACGTGTCACGTTCTCTTAAACGTGACACGTTCGGAGAAC‐3’ (reverse).
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.